Shadows of Messiah – DNA

DNA is a physical picture of the Word of God — a language that functions exactly like Hebrew, the tongue that traces back to Eden. Never seen directly, only its shadow, DNA serves as the instruction manual that forms our bodies, just as the Word became flesh in Messiah (John 1:14).


In this study we explore how the 22 amino acids correspond to the 22 letters of the Hebrew Aleph-Bet, how 46 chromosomes reflect the union of Hebrew (22) and Greek (24) letters, and how the double helix, codons, transcription, and the cross-shaped chromosomes all shadow the Messiah who is the Living Word, the Alpha and Tav, the true Blueprint of Life. From etymology to the epigenome, every layer reveals the divine language written into creation — pointing to Jesus, in whom “all things hold together.”

DNA is a physical picture of the Word of God, it is a language that functions exactly the same as Hebrew, the language that traces back to Eden.  DNA is the language of the book that is used to form our bodies, just as the Hebrew language is the language of the Word who became flesh and dwelt among us.  DNA itself has never been seen, only its shadow.  So too, God has never been seen (John 1:18; 5:37)…only His ‘shadow’ revealed in His Word. DNA forms the body. The Word became flesh in Christ Jesus (John 1:14; Psalm 40:7; Hebrews 10:5).

The DNA molecule is the instruction manual for the forming of amino acids which make the structural elements of proteins that turn into the biochemical units that drive all biological processes.
The proteins formed from the amino acids which the DNA molecule makes are 22 in number corresponding to the 22 letters in the Hebrew Aleph-Bet.  These 22 letters point to Christ Jesus who is described as the Alpha & Omega/Aleph – Tav.  The Bible (Word of God) was written in both Hebrew and Greek. In Hebrew there are 22 letters, in Greek there are 24 which combine to make 46, the number of chromosomes in each cell.

The Hebrew word for letter is אות ‘oht’ which comes from the root את {Aleph Tav}.  The 22 letters of the Hebrew Aleph-Bet form the Image of the Messiah who is the Word made flesh.  This is seen in the physical realm in our bodies where the DNA forms 22 amino acids which make the proteins for each individual part of our bodies.

Isa 8:18  Behold, I and the children {Messiah and His body} whom Jehovah has given to me are for signs (אתות – ‘letters’) and wonders in Israel from Jehovah of Hosts, who dwells in Mount Zion.

DNA forms 46 chromosomes in the human body. When you add the 24 letters of the Greek alphabet to the 22 letters of the Hebrew alphabet you get 46. The combing of the Hebrew Old Testament and the Greek New Testament reveals this parable. Chromosomes appear as a cross.


1Co 1:18 For the Word of the cross is foolishness to those being lost, but to us being saved, it is the power of God.

Etymology of DNA

DNA is an abbreviation for deoxyribonucleic acid.  When breaking down the different parts of this word it is seen that etymologically DNA points to the Word of God.  This is no surprise as functionally, DNA is a picture of the Word.

The first part of the word is ‘de’ which means ‘from or according to.’  As in ‘de facto’ meaning “in fact” or “reality” in Latin. This could translate into Hebrew as ל ‘lamed’ or מ ‘mem.’  In Aramaic the ‘d’ in front of a word is the same as ב  ‘b’ in Hebrew.

de – from, down from

The next part of deoxyribonucleic acid is the oxy.  Oxy is a Greek word which means sharp or pungent.  It is the origin of the word acrid.  Oxy/Oxus in Greek traces back to the Hebrew word קוץ ‘qots’ which means a thorn, or sharp.  It is the origin of the Latin word ‘acacia’ which means a thorn and is used in reference to the wood used in the Tabernacle which is a major theme of this study as the Tabernacle was a shadow picture of Messiah (His Body), and consequently the Word.

deoxyribonucleic acid.
Ribose comes from the Hebrew word חלב ‘chalav’ and is related to gum and the Hebrew word גמא ‘gome.’  These all connect to the Word which will be discussed in more detail below.  גמא ‘gome’ is the source for papyrus/paper and the Bible (Exodus 2:3).

deoxyribonucleic acid.
The word nucleic means ‘something that comes from the nucleus.’  Nucleus comes from the Latin word ‘nucleus’ which means a ‘kernel, little nut.’  The word kernel comes from Germanic word ‘kurnilo’ which means the root of corn, ‘seed/grain.’  Kernel traces even farther back to the Hebrew word כרמל ‘karmel.’  כרמל ‘karmel’ means a seed but a seed planted in a Garden in particular.

The word nucleus also links back to the Hebrew word קמט ‘qamat’ which has the meaning of compressing.  קמט ‘qamat’ is the origin of the Old English word ‘hem’ which was a doubling over or compressing of the hem.  Interestingly, on the hem of the garments of Messiah were placed ציצית ‘tsitsit’ (tassels) where are intimately linked with DNA.

The final part of deoxyribonucleic acid is the word acid.  Acid comes from the Latin ‘acidus’ meaning sour or sharp.  Tracing the word acid farther back links it with the Hebrew word זית ‘zayit’ which means the olive tree.  The Olive tree is a picture of Christ/the Word/the Tree of Life which will be discussed in more detail below.

de – according to
oxi – sharp (Hebrews 4:12 the Word is sharp, like unto a two edged sword)
ribo – sweet (Psalm 119:103) Papyrus/Word
nucleic – Seed (Luke 8:11)
Acid – Olive (Tree of Life – Romans 11).

This etymology aspect of DNA may not make a lot of sense now but it shown here to display the connection between DNA and the Word of God.  This is the foundation of this study and will be addressed throughout this article.

Life

Life comes forth from the instructions in the DNA molecule.  The Holy Scriptures proclaim that the Word = Life.

Joh 6:63  It is the spirit that quickeneth; the flesh profiteth nothing: the words that I speak unto you, they are spirit, and they are life.  {See also Deuteronomy 32:47; 1John 1:1-2; Philippians 2:16; John 11:25; 14:6; 1John 5:20.}

The English word life comes from the Hebrew word חלה ‘chalav’ which means ‘fat, choicest part, milk.’  Interestingly, the word protein traces back to this same Hebrew word.  Life comes forth from the proteins produced by the DNA molecule in the cell of living organisms…

Life and its connections to the current study are discussed in more detail in Messiah in the Torah: Genesis 1:20-23.

Protein & Hebrew

The English word protein traces back to the Hebrew word עבר ‘avar’ which is from whence the word ‘Hebrew’ {עברית ‘ivrit’} comes from.  Protein comes from the Greek word πρῶτος ‘protos’ which also derives from this word עבר ‘avar.’

E-Word Dictionary – Isaac Mozeson pg 312


Notice that the word עבר ‘avar’ is related to the word בר ‘bar’ which means ‘son’ (Psalm 2:12).  It is no surprise then that the prophet Isaiah (Isaiah 8:18) speaks of those who are in Messiah as signs/letters (אות ‘oht’) and children/’protein’.  Recall that the 22 amino acids which correspond to the 22 letters of the Hebrew Aleph-Bet make proteins which correspond to the Hebrew language.

In other words, in the natural we see that a book/word is used to form our natural bodies in correspondence with THE Word which is used to form the “body” of Christ.

DNA & Language

The different aspects of DNA work in similar fashion to the formation of a book.

Nucleotide bases        Character (Letter)
Codon            Letter
Gene            Word
Operon            Sentence
Regulon        Paragraph
DNA            Book

In a simpler version it could be said that the Nucleotide bases correspond to the letters in the Alphabet.  The codons correspond with words.  Genes correspond with sentences.  DNA corresponds with the Book (Bible).

The ‘letters’ of the DNA strand are comprised of Adenine, Guanine, Cytosine and Thymine (A,C,G,T).  These four letters combine in pairs to make all the information needed to form life.  Adenine always pairs with Thymine and Guanine with Cytosine (A-T & G-C).  This points to the Hebrew language where all words come forth from a 2 letter parent root.

2 Letter roots are known as ‘parent roots.’  2 Letter roots usually add a third letter in order for the word to be conjugated.  This 3 letter root is called the child root.  {For more two letter roots see, Jeff Benner’s work on the Hebrew Language}

This is also alluded to in Scripture.  Isaiah speaks of the book of the LORD and the ‘mates’ (father and mother) therein.

Isa 34:16  Seek ye out of the book of the LORD, and read: no one of these shall fail, none shall want her mate: for my mouth it hath commanded, and his spirit it hath gathered them.
These 2 letter parent roots, for the most part, can’t be used in language without the adding of another letter to form the 3 letter root of which most are familiar with in the Hebrew language.  In DNA, this process happens through the means of messenger RNA.  RNA is an exact copy of the DNA molecule where the helix ladder ‘unzips’ itself in order to make an exact copy.

DNA then is a picture of the Father on His throne.  The messenger RNA is a picture of Messiah who comes to earth to bring many sons to Glory.  This DNA to RNA and back to DNA process is also seen in the work of the Scribes who made exact copies of the Word of God.

DNA transcription

“…the genetic code can be best understood as an analogue to human language. It functions exactly like a code — indeed, it is a code: it is a molecular communication system within the cell…
In recent years, scientists have applied information theory to biology, and in particular to the genetic code… It provides a mathematical means of measuring information…

The conclusion drawn from the application of information theory to biology is there exists a structural identity between the DNA code and a written language…

Molecular biology has now uncovered an analogy between DNA and written human languages. It is more than an analogy, in fact: in terms of structure, the two are ‘mathematically identical.’…”

“A team of Russian geneticists and linguists, researching the electromagnetic behavior of DNA, discovered that “junk” DNA is critical not only for the construction of our body but also in data storage and communication. The Russian team discovered that this 90% of our DNA follows the same rules of grammar, syntax and semantics as human languages. Their conclusion is that human language mirrors the structure of our DNA.”   {DNA, Design, and the Origin of Life -Charles B. Thaxton, Ph.D.}

Hebrew grammar

DNA works in the same way as the Hebrew language.  Each Hebrew word traces back to a 2 letter ‘parent root.’  This parent root, for the most part, can’t be used in a sentence without the addition of a 3rd letter.  Hebrew verbs require a 3 consonant root in order to be conjugated.  This 3 letter root is called the ‘child root.’

The DNA helix is formed through the combination of 2 nucleotides,  Adenine and Thymine or Cytosine and Guanine combinations.  In order for amino acids of the genetic code to be formed into proteins the nucleoside must combine into 3 letter combinations to make ‘codons.’

The genetic code consists of 64 codons and the amino acids specified by these codons.  When the DNA is in the nucleus, the DNA contains two letter pairs held together by hydrogen bonds.  The letters are unable to form a body without leaving the nucleus and taking on a 3rd letter, just like the Hebrew language.  In order to take on a 3rd letter the DNA helix must “unwind”, where it copies itself onto messenger RNA.  The letters then make one long string of letters.  Just like an ancient Torah scroll.

The DNA strand is made of letters:
ATGCTCGAATAAATGTGAATTTGA

The letters make words:
ATG CTC GAA TAA ATG TGA ATT TGA

The words make sentences:
<ATG CTC GAA TAA> <ATG TGA ATT TGA>

These “sentences” are called genes.  Genes tell the cell to make other molecules called proteins.  Proteins allow a cell to perform special functions, such as working with other groups of cells to make hearing possible.

NOVA – Ghost in Your Genes
“The DNA letters are “transcribed” by Messenger RNA, just as Scribes transcribed one Torah scroll onto another scroll.  The messenger RNA is also called the Servant RNA.  The Messenger RNA can go outside the nucleus, whereas the DNA must stay inside the nucleus.  The DNA does not leave the nucleus in order to preserve the original copy.  If the mRNA obeys the rules He will overcome the mutations (sins) of the world when He enters the cytoplasm.

The mRNA leaves the nucleus through a hole called the gatekeeper, that prepares the way for the mRNA to leave the nucleus.  When the mRNA leaves the nucleus it is translated.”

The 3 letters ‘child roots’ represent amino acids.  There are 22 amino acids that are read by the ribosomes to produce protein.  These amino acids are divided up into codons, from whence we get the English word ‘code.’  These words trace back to the Hebrew word סוד ‘sod’ which is usually translated as hidden or secret.  Literally the word סוד ‘sod’ is speaking of close friends congregating in a tent, ie the Tabernacle/Temple.  The cells in our bodies are pictures of the Tabernacle/Temple of God.  This will be spoken of in more detail later.

Murray Eden of MIT, one of the mathematicians attending the Wistar Institute Symposium in 1966:

“DNA, like other languages, cannot be tinkered with by random variational changes; if that is done, the result will always be confusion…No currently existing formal language can tolerate random changes in the symbol sequences which express its sentences.  Meaning is invariably destroyed.”

You can not add or take away from the DNA or a mutation results.  So too, we cannot add or take away from the Word of God or “mutation” occurs.

Deu 12:32  All the things that I command you, take heed to do them and you shall not add to it, nor take away from it.
Mat 5:17  Do not think that I came to annul the Law or the Prophets; I did not come to annul, but to fulfill.

The genetic information that is read by the ribosomes determines what will be formed.  Interestingly, tracing back the word ‘information’ brings forth the same concept.  The English word ‘information’ comes from the Latin word ‘informare’ which means to shape, form, train, instruct, educate, etc.

‘Informare’ breaks down from ‘in’ meaning into and ‘forma’ meaning a form.  The English word ‘form’ comes from the Old French word ‘forme’ which means a physical form, appearance, shape, image etc.  This traces to the Latin word ‘forma’ which further traces to the Greek word μορφή ‘morphe’ meaning form, beauty, outward appearance.

This word μορφή ‘morphe’ is interesting as it is used in only a few places in the New Testament, all of which are referring to Christ  (Mark 16:12; Philippians 2:6-7; Galatians 4:19).  μορφή ‘morphe’ comes from the root μέρος ‘meros’ which means the constituent parts of a whole or combining small parts to make an image.  This describes DNA becoming protein (image) very well.  μορφή  ‘morphe’ is used to translate multiple Hebrew words in the Septuagint, all of which link to the current study.

G3444
morphe     H2122    ziv – an image that stands out
morphe     H6754    tselem – shadow, image
morphe     H8389    toar – mark or image, discussed in greater detail above.
morphe     H8403    tavnit – image, pattern- the word used for pattern in reference to the Tabernacle/Temple of God.  The Tabernacle/Temple of God is a picture of Messiah and His body.

morphe     H8544    temunah – Image, form- the root of this word is ‘מן’ which means ‘living waters/blood’ usually translated as type or kind which is linked to the passing of genes from father to son through ‘the blood.’

Epigenome

The significance and importance of the epigenome has only recently been discovered by scientists.  The genetic material which makes our eyes, ears, nose, feet, liver, heart etc., are all the same.  It is the epigenome that translates this information to make each part what it is.  This corresponds to the Holy Spirit.  The Scriptures can be read by anyone yet it is only through the Holy Spirit that one can understand and see the ‘image’ of God.

Interestingly, the epigenome doesn’t alter the DNA sequence, it ‘turns on’ or ‘turns off’ different parts of the sequence.  A good example of this is cancer.  Cancer may be caused by several different mutations or epigenetic changes that cause genes to be expressed (turned on) and/or silenced (turned off) when they should not be.

Cancer is an aberration in the cells which leads to death which can be caused by mutations (adding or taking away) or by certain parts of the ‘Word’ being ‘turned on or off.’  Not only does changing the Word lead to death, but misinterpretation of the Word.

Rom 7:24  O wretched man that I am! Who shall deliver me from the body of this death?
Rom 7:25  I thank God through Jesus Christ our Lord! So then I myself with the mind truly serve the Law of God, and with the flesh the law of sin.

The epigenome that ‘translates’ the genetic code is likened to the Spirit.  The Holy Spirit teaches man and leads him to interpret the Word of God correctly where he can be formed into the Image of Messiah (2 Corinthians 3:18; Galatians 4:19; Romans 8:29) whereas the spirit of evil works in the children of disobedience where the Word is corrupted and leads to them being formed into the corrupted man of sin (Ephesians 2:2-3; Isaiah 1:4; 57:4; 1 Peter 1:13-16).

Interestingly, DNA is dwelling in the midst of a matrix of water.  The fact that it is in water plays a crucial role in how it gets its helix ladder shape.  Because the four DNA bases are insoluble in water, they turn towards the interior molecule to form and join the two letter ‘roots.’  They then wrap themselves around each other to avoid contact with their wet environment.  The epigenome is then likened to the Spirit hovering over the waters in the beginning.

Gen 1:2  And the earth was without form, and void; and darkness was upon the face of the deep. And the Spirit of God moved upon the face of the water.
Gen 1:3  And God said, Let there be light; and there was light.

Psalm 139 speaks of man being formed in the womb and on a deeper level alludes to the DNA molecule.

Psa 139:15  My bones were not hidden from You when I was made in secret; when I was woven {רקם ‘râqam’} in the depths of the earth.

The word translated as ‘woven’ in this verse is רקם ‘râqam’…this words means fashion, needlework or twisted threads (DNA).

Psa 139:16  Your eyes saw my embryo; and in Your book (an allusion to DNA the ‘book of life’) all my members were written the days they were formed, and not one was yet among them.

Psalm 139:15 likens womb to the depths of the earth.  In Hebraic thought, the womb is also likened to waters.  DNA also produces ‘light.’  Here we see a replay in our very cells of the beginning of the universe where light came forth from a matrix of water.

Ribosomes

The ribosomes ‘read’ the 22 amino acids in order to form proteins.  Ribosomes are a picture of scribes.

The word ribosome comes from ribose which is a ‘sugar’ that is formed from ‘gum arabic.’  Tracing back this word gum brings forth some interesting connections to scribes.  Gum arabic comes forth from the acacia tree mentioned above and is used in the process of making ink for ancient Torah scrolls.  More on this below. In the Scriptures, gum is translated from the word חלבנה ‘chalvanah.’  This is translated as ‘galbanum’ as in Exodus 30:34.

חלבנה ‘chalvanah’ comes from the root חלה ‘chalav’ which means the fat or choicest part.  This was what was offered to God on the altar along with the kidneys and liver (Exodus 29:13).

Interestingly, the English word liver comes from the Hebrew word חלה ‘chalav’ as well.  This is also the origin of the English word ‘lip’ which is made up of fatty tissue.

The word ‘lobe’ as in the ear lobe comes from חלה ‘chalav’ too.  It is not hard to see the connection between lips, hearing (earlobe) and scribes (Proverbs 8:6).

The English word ‘gum’ comes from the Hebrew גם ‘gam.’

גם  ‘gam’ has the meaning of a collection of a group of animals at a watering hole, in particular camels as seen in Genesis 24.  גם  ‘gam’ (gimmel) is the number 3 in Hebrew which is linked to resurrection and maturity which is a major theme of the current study on the mark.

The Hebrew letter ג ‘gimel’ originally was pronounced as גם ‘gam.’

Ancient Hebrew Lexicon of the Bible pg 22

This word links back to baptism, as seen above, as the meaning of collecting at the waters.  To further illustrate this, the word אגם ‘agam’, which comes from the root גם ‘gam’ is translated as pool in English, just as מקוא ‘miqveh’ (baptism) is.  The connection between גם ‘gam’ and scribes/the Word is seen in more detail in Messiah in the Torah: Genesis 1:9-13.

Amazingly, the account of Moses being drawn out of the waters after being hidden for 3 months is linked to this word.

Exo 2:3  And she was not able to hide him any longer, and she took a basket for him made of papyrus (גמא ‘gome’ from the root גם ‘gam’ , and she daubed it with bitumen and with pitch. And she put the child in it, and placed it in the reeds by the lip of the Nile.

The Hebrew letter ג ‘gimmel/gam’ is a pictograph of a foot but also represents a camel.

The Holy Scriptures link the camel to the gathering of the waters:

Gen 24:11  And he made the camels kneel {ברך ‘barakh’} outside the city, by a well of water at the time of the evening, the time that women go out to draw.

This word ברך ‘barakh’ connects with the word גמל ‘gamal’ through the concept of a ‘pool.’  The word pool is translated from 3 different Hebrew words.  אגם ‘agam’ and מקוה ‘miqveh’ mentioned before, and ברכה ‘berakah.’

This word comes from the root:

Notice that the parent root of this word is בר ‘bar.’  This is the word for Son (Psalm 2:12).  It is also the root for the word for soap.

Washing of the body, as well as washing of the clothing points to Christ.  At Mt. Sinai, Israel was to was their clothing and be ready for the 3rd day when they would meet God.  Interestingly, the human body was designed to bathe with soap every 2-3 days.

The word above, בר ‘bar’, is translated as son in Psalm 2:12; Proverbs 31:2 & Daniel 3:25, and is used in reference to the Word of God in Psalm 19:8.  The link here is clear.  The need for the body & our clothing to bathe in water and soap is a picture of man needing to be covered in the garments of the Word/Jesus.

Psa 24:3  Who shall go up into the hill of Jehovah? And who shall rise in His holy place?
Psa 24:4  He who has clean hands and a pure heart; who has not lifted up his soul to vanity and has not sworn deceit.
Psa 24:5  He shall lift up the blessing
(ברכה ‘berakhah’) from Jehovah, and righteousness from the God of his salvation.
What is the blessing (ברכה ‘berakhah’)?

Psa 133:3  like the dew of Hermon coming down on the mountains of Zion; for there Jehovah commanded the blessing: life till everlasting.
Act 3:25  You are sons of the prophets and of the covenant which God appointed our fathers, saying to Abraham, “Even in your Seed all the families of the earth shall be blessed.“ Gen. 22:18
Act 3:26  Having raised up His child Jesus, God sent Him first to you, blessing you in turning away each one from your iniquities.
This blessing is seen in the natural realm, as described in the book of Hebrews, pointing back to the 3rd day of creation

Heb 6:7  (For the earth drinking in the rain often coming upon it, and producing vegetation suitable for those for whom it is also worked, receives blessing from God;
Heb 6:8  “but bearing thorns and thistles,” it is deemed unfit and near a curse, of which the end is for burning.)
Gen. 3:17, 18

Being clothed with His righteousness is linked with the earth springing forth plants.

Isa 61:10  Rejoicing I will rejoice in Jehovah. My soul shall be joyful in my God. For He clothed me with garments of salvation; He put on me the robe of righteousness, even as a bridegroom dons as a priest his head-dress, and as a bride wears her ornaments.
Isa 61:11  For as the earth comes out with her buds, and as a garden causes that which is sown to grow, so the Lord Jehovah will make righteousness and praise to grow before all the nations.


Back to the letter ג ‘gimmel’…

The letter gimmel points to completion, just as the number 3 through does.

Psa 57:2  I will cry to God Most High, to God who works (gamar=perfects) for me.
Psa 138:8  Jehovah will perfect His work in me; O Jehovah, Your mercy endures forever; You will not forsake the works of Your hands.
This concept of working to perfection through God’s Word/Image being formed in us is seen further in:

2Ti 3:16  All Scripture is God-breathed and profitable for doctrine, for reproof, for correction, for instruction in righteousness,
2Ti 3:17  so that the man of God may be perfected, being fully furnished for every good work.

The Wisdom in the Hebrew Alphabet pg 71
“The גימל gimmel, is cognate to גמל gamol, which means to nourish until completely ripe, as in ויגמל שקדים, it produced mature almonds (Numbers 17:23).  Of Isaac, the Torah states: The child grew, ויגמל, and was weaned (Genesis 21:8); there gamol refers to the development of an infant to the point that it can live without it’s mother’s nursing.”

It is interesting to note that in the book of Maccabees the period of time that the mother nursed the child was 3 years.

2Ma 7:27  But she bowing herself toward him, laughing the cruel tyrant to scorn, spake in her country language on this manner; O my son, have pity upon me that bare thee nine months in my womb, and gave thee such three years, and nourished thee, and brought thee up unto this age, and endured the troubles of education.

This concept of maturity being linked with being weaned is further seen in the book of Hebrews
Heb 5:12  For indeed because of the time you are due to be teachers, yet you need to have someone to teach you again the rudiments of the beginning of the Words of God, and you came to be having need of milk, and not of solid food;
Heb 5:13  for everyone partaking of milk is without experience in the Word of Righteousness, for he is an infant.
Heb 5:14  But solid food is for those full grown, having exercised the faculties through habit, for distinction of both good and bad.

Heb 6:1  Because of this, having left the discourse of the beginning of Christ, let us be borne on to full growth, not laying down again a foundation of repentance from dead works, and of faith toward God,
Heb 6:2  of baptisms, of doctrine, and of laying on of hands, and of resurrection of dead ones, and of eternal judgment.
Heb 6:3  And this we will do, if indeed God permits.
Heb 6:4  For it is impossible for those once having been enlightened, and having tasted of the heavenly gift, and becoming sharers of the Holy Spirit,
Heb 6:5  and tasting the good Word of God, and the works of power of a coming age,
Heb 6:6  and having fallen away, it is impossible for them again to renew to repentance, crucifying again for themselves the Son of God, and putting Him to open shame.

Notice that Paul links this concept of maturity with the springing forth of plants and fruit
Heb 6:7  (For the earth drinking in the rain often coming upon it, and producing vegetation suitable for those for whom it is also worked, receives blessing from God;
Heb 6:8  “but bearing thorns and thistles,” it is deemed unfit and near a curse, of which the end is for burning.)
Gen. 3:17, 18

To further show this connection, the word for ‘complete/mature’ is:


כל ‘kol’ is the source for the English word ‘cell.’  This is a fascinating connection as it is the ribosomes which read the amino acids (22 letters) which makes proteins that form our cells.

The Hebrew word for food comes from this same root:

On the 3rd day the plants, trees and fruit appeared which became food for man.

Gen 1:30  And to every beast of the earth, and to all birds of the heavens, and to every creeper on the earth which has in it a living soul, every green plant is for food. And it was so.
Gen 2:9  And out of the ground Jehovah God made to spring up every tree that is pleasant to the sight, and good for food. The Tree of Life was also in the middle of the garden; also the Tree of the Knowledge of Good and Evil.

It is interesting that when Isaac was weaned (found mature) there was then a feast (Genesis 21:8).  If Isaac was 3 years old, that would connect to the birth of the ‘manchild’ of Revelation 12 & Isaiah 66:7-8, who partakes of the Wedding Supper 3 1/2 years after.  Isaac is further linked to the manchild through Psalm 126.  When the captivity is ended, our mouths will be full of laughter (sechoq – same root as Isaac ), Sarah’s barren womb is a picture of Zion (Isaiah 49:13-23; 54:1-3; 66:7-11).  It is believed that Isaac was born at Passover which would link to the ‘manchild’ in Revelation 12 who flees to the wilderness for 3 1/2 years.  Subtracting 3 1/2 years from the Fall Feasts which are a picture of Messiah’s return, brings one to the time of Pesach.

The word for bride comes from the same root, כל:

It was on the 3rd day that the bride appeared before God at Mt. Sinai.

Exo 19:10  And Jehovah said to Moses, Go to the people and sanctify them today and tomorrow. And let them wash their clothes.
Exo 19:11  And be ready* for the third day. For on the third day Jehovah will go down before the eyes of all the people on the mountain of Sinai.

*The Hebrew word here is כון ‘kun’ which means to stand, firm.  It comes from the following root word in Hebrew:

This word points to the resurrection and links to the 3rd day of creation.  It is on the 3rd day (Hosea 6:2 that the bride is resurrected into the image of Messiah (clothes are cleansed Ephesians 5:26-28) to meet her bridegroom.  The Hebrew word for priest, kohen, comes from this root, as the priest is a support/pillar of the community.

כון ‘kun’ is a picture of a plant rising out of the ground which also links to the Word. Bible & Papyrus.

The words for Bible and Papyrus come from same word in Hebrew ‘אבוב’ ‘avoov’.

‘ABOOBH’ is a hollow pipe or tube derived from jointed reeds or knotgrass, an extension of AiBHeH (reed – Job 9:26).”  {E-Word – Isaac Mozeson pg 560}

אבוב ‘aboobh’ comes from the root אב ‘av’ which is the word for Father.

Going back to the ribosome ‘gum’ connection.

“GUM, sticky resin, was first produced from lakeside plants, thus from אגם, lake, pond.  This material was later replaced by the rubber plant, but the GUM name stuck.” (E-Word pg 518)

גמא ‘gome’ is the source of the word ‘papyrus’ which is the source for paper and Bible as seen below.

DNA Backbone

One strand of DNA has a backbone consisting of a polymer of the simple sugar deoxyribose bonded to something called a phosphate unit.

The nucleotides (letters) of the DNA strand attach to this sugar-phosphate backbone.

There are 4 different types of sugar-phosphates.

Dihydroxyacetone phosphate (DHAP)

Glucose 6-phosphate

Phytic acid

Teichoic acid

The etymology of the words ‘sugar’ and ‘phosphate’ bring forth interesting connections to the current study as well.

Sugar comes forth from the Old French ‘sugar’ which traces back to the Arabic ‘sukkar’ and then to the Hebrew word שכר ‘shakar.’

E-Word -Isaac Mozeson pg 760

The word ‘phosphate’ comes from the Latin word ‘phosphorous’ which traces further to the Greek word ‘phosphoros’ which is translated as ‘morning star’ from ‘phos’ meaning light and ‘phoros’ meaning to carry or bear.  The Morning Star in Scripture is speaking of Messiah (Revelation 2:28; 22:16).  Interestingly, modern science has found that DNA contains biophotons and weak proton emissions, a.k.a. light.

Phosphorus ultimately traces back to the Hebrew word פז (paz) which means fine gold (yellow).

E-Word Isaac Mozeson pg 555

Isaac Mozeson’s research into Edenics and the etymology of all languages tracing back to Hebrew brings forth some interesting connections to phosphorus.  As seen in the above image, the word ‘topaz’ traces back to ‘paz’ as well.

E-Word – Isaac Mozeson pg 809

The serpent connection has multiple meanings.  This traces back to the serpent in the Garden of Eden and the tree of knowledge.  This is discussed in the series on the Mark of the Beast: the Great Counterfeit.  However, serpents are not entirely evil in the scheme of creation.  They are connected to wisdom and the Word as well.

The word for parchment in Greek is μεμβρανα ‘membrana’ which means a parchment of skins from the Latin word ‘membrana’ which means ‘thin skin, film membrane’ (2 Timothy 4:13).  This word is used of skin of a snake or the skin prepared to write on a parchment like a scroll.’

Delving deeper into the etymology of phosphorus and פז ‘paz’ brings forth even more interesting connections to the current study.  ‘Asfar’ the Arabic word for yellow, which comes from the Hebrew פז ‘paz’ is also a ‘branch’ of the Hebrew word מצבה ‘matsebah’ which is usually translated as ‘pillar.’  This is the word used in the Torah in Genesis 28 at Bethel (House of God) where Jacob encounters the ladder which reaches to heaven and where he anoints the pillar (מצבה ‘matstsebah’).  This ladder is intimately connected to the DNA helix as will be discussed below.  The ladder, the pillar etc., all point to Messiah.

E-Word pg 461

The Word is likened unto ‘sugar.’

Psa 135:3  Praise the LORD; for the LORD is good: sing praises unto his name; for it is pleasant.

The word ‘delightful’ in the Hebrew is נעם ‘na’am’ which means pleasant, delightful, beautiful, sweet.

The Hebrew word for ‘their delicacies’ in Psalm 141:3 is מנעמיהם ‘manamayhem’ which literally means ‘their sweets.’  This word is closely related to נעים ‘naiym’ which also means sweet, pleasant or beautiful. נעים  ‘naiym’  is used in reference to the name of God in Psalm 135:3.  Scripture equates His Name with His Word (Revelation 19:13)…this is the sweet delicacy we are to seek.  In nature the same thing can be seen.  The sugars of fruits and the sweetness of honey which God created are good for our bodies, in moderation as you said…the sugars that man creates are detrimental.

The Oracles/Word of God is to be in our mouth (1 Peter 4:11) which are sweet (Psalm 19:10; 119:103; 135:3).  DNA, which is a picture of the Word of God is made up of a sugar phosphate backbone which further links the concept of sweetness with His Word.  Science has found that our words affect our DNA (for the good or evil), with the greatest effect being love and forgiveness.  God (and His Word which reveals His character) is love (1 John 4:8, 16).  Creation is a reflection of God’s Word and His love.  This sweetness found in nature points to His Word/love.

Sir 24:20  For my memorial is sweeter than honey, and mine inheritance than the honeycomb.

The Memorial is connected with God’s Word

Psa 19:7  The law of the LORD is perfect, converting the soul: the testimony of the LORD is sure, making wise the simple.
Psa 19:8  The statutes of the LORD are right, rejoicing the heart: the commandment of the LORD is pure, enlightening the eyes.
Psa 19:9  The fear of the LORD is clean, enduring for ever: the judgments of the LORD are true and righteous altogether.
Psa 19:10  More to be desired are they than gold, yea, than much fine gold: sweeter also than honey and the honeycomb. {Notice the connection here between fine gold (paz …phosphorus) and honey (a type of sugar)
Psa 19:11  Moreover by them is thy servant warned: and in keeping of them there is great reward.
Psa 119:103  How sweet are Your Words to my palate! More than honey to my mouth!
Psa 119:104  By Your Precepts I know; so then I hate every false way.


The Word is likened unto Light ‘phosphorus’

Psa 119:130  The entering of Your Word gives light, giving discernment to the simple.

His Name is His Word

Rev 19:13  And he was clothed with a vesture dipped in blood: and his name is called The Word of God.

As seen in the series of studies on the mark of the beast, His Name/Word is associated to the mark as this is what will be in the hand/head of His believers (Revelation 14:1; 22:4; Deuteronomy 6:6-8).  The mark of the beast is the counterfeit name/word in the hand/head of his followers.

DNA & the Name

Gregg Braden in his book the God Code, speaks of the DNA sequence in man revealing the sacred name of God.

“Through determining their simple mass, the elements of DNA (hydrogen, nitrogen, oxygen and carbon) within our bodies may now be replaced with four letters of the Hebrew alphabet: Yod, Hey, Vav, and Gimel, thus revealing that our DNA may be read literally as a translatable alphabet within each of our cells.” {The God Code pg 112}

The God Code pg 135

“When we substitute modern elements for all four letters of God’s ancient name, we see a result that, at first blush, may be unexpected.  Replacing the final H in YHVH with its chemical equivalent of nitrogen, God’s name becomes the elements hydrogen, nitrogen, oxygen and nitrogen (HNON) – all colorless, odorless, and invisible gases!  In other words, replacing 100 percent of God’s personal name with the elements of this world creates a substance that is an intangible, yet very real form of creation!”

“Additionally, the first chapters of Genesis relate that it is in a nonphysical form that the Creator was present during the time of creation (Genesis 1:2).  It was the ‘spirit of God’ that first moved over the face of the earth.”

“The Sepher Yetzirah further describes the first Hebrew letter to emerge from the void of creation as the Mother Letter that made the universe possible: Alef.  Through a great, mystical ‘secret’ Alef then evolved into the first element to appear in our universe, hydrogen, as well as the first letter of God’s name : Yod.”  {The God Code pg 136}

For more on this see Shadows of Messiah – Chemistry.

Joh 5:43  I have come in the name of My Father, and you do not receive Me. If another comes in his own name, you will receive that one.

The God Code pg 151

Jesus came in the likeness of man “YHVG” (Romans 8:3), but also in the Name of the Father Yahweh “YHWH” (John 5:43).  It is interesting that Jesus in Greek = 888.  The man of sin = 666. {The number 666 is a “poison book“}

Bodies & Books

Our bodies are pictured by books.

Psa 40:7  Then said I, Lo, I come: in the volume of the book it is written of me,

‘Tome’ is the root of the word anatomy

In the same passage of Scripture mentioned above in reference to Messiah, it speaks of the body being given to Him.

Heb 10:5  For this reason, coming into the world, He says, “Sacrifice and offering You did not desire, but You prepared a body for Me.
Heb 10:6  You did not delight in burnt offerings and sacrifices concerning sins.”
Heb 10:7  “Then I said, Lo, I come, in the heading
{κεφαλίς ‘kephalis’}of the Book (βιβλίον ‘Biblion’) it was written concerning Me, to do Your will, O God.” LXX-Psa. 39:7 -9; MT-Psa. 40:6 -8

G2777
κεφαλίς
kephalis
Thayer Definition:
1) a little head
2) the highest part, extremity of anything
2a) as the capital of a column
2b) the tips or knobs of the wooden rod around which parchments were rolled were called by this word, because they resembled little heads
3) the Alexandrian writers transferred the name to the roll or volume itself
3a) in the roll of the book
Part of Speech: noun feminine
A Related Word by Thayer’s/Strong’s Number: from G2776

In Hebrew this word is ‘megillah’ which is also related to the ‘head’.  The word golgolet (Golgotha/skull) comes from this same root in Hebrew meaning round. The word ‘megillah’ is related to the Hebrew word ‘galgal’ (circle) which has the numerical value of 66, referring back to the 66 books of the Bible.

The word for ‘chapter’, also means a ‘head’ from the Latin capitulum.

Traditionally, Torah scrolls were treated like living beings.  They were clothed and when they wore out they were buried.  The armor worn by a man (specifically speaking of Messiah) as mentioned in Isaiah 59:13; Ephesians 6:11 corresponds with the clothing of a Torah Scroll. The Armor of God is linked with baptism in Messiah and becoming a new creation (Ephesians 6:11-18; Romans 13:13-14; Galatians 3:27; Colossians 3:9-11).

The word in Greek for armor is ‘panoplia’ which is used to translate the Hebrew word ‘chalatz’ in the Septuagint

Going back to the word anatomy, as seen above it used to be a synonymous word with ‘skeleton.’

Notice that the word skeleton traces back to the meaning of ‘dried up.’ Interestingly, the body of Messiah is likened to dry bones העצמות היבשׁות in Ezekiel 37 which is resurrected and brought back to the life in the land of Israel.

The word for bone in Hebrew comes from the word עץ ‘ets’ meaning a tree…it is no coincidence that Ezekiel 37 speaks of bones in reference to the resurrected body of Messiah and then speaks of 2 trees becoming one in reference to His body.

There are 206 bones in the human skeleton.  Here are a few times that the numerical value of 206 is seen in the Scriptures.  Notice the connections to the current study.

The etymology of the word codex comes from a block of wood.

In the 5th century, Isidore of Seville explained the relation between codex, book and scroll in his Etymologiae (VI.13): “A codex is composed of many books; a book is of one scroll. It is called codex by way of metaphor from the trunks (codex) of trees or vines, as if it were a wooden stock, because it contains in itself a multitude of books, as it were of branches.”

Those who are reborn in Messiah will be in His image.  Walking Bibles.


2Co 3:3  it having been made plain that you are Christ’s letter, served by us, not having been inscribed by ink, but by the Spirit of the living God, not in tablets of stone, but in fleshly tablets of the heart.

The word for letter above is the Greek word ‘epistole’ (Epistle) which comes from the Hebrew word אגרת ‘egeret.’  In Hebrew ‘agar’ אגר means to gather and the letter ת tav means the cross/covenant.  2 Corinthians 3:3 describes the New covenant (Jeremiah 31:31; Hebrews 8:8; 10:16; Ezekiel 11:16-20; 36:26).  Interestingly, אגר ‘agar’ comes from the root גר which literally means a ‘walking man.’  It is translated as a sojourner, traveler, and as a stranger (Genesis 17:8; 47:9; Leviticus 25:23; Psalm 39:12; 1 Peter 2:11; 1:17; Hebrews 11:9, 13-16; 13:14).

Interestingly, the word for ink in 2 Corinthians 3 is from the Greek word μέλαν ‘melan.’

G3188
μέλαν
melan
Thayer Definition:
1) ink
Part of Speech: noun neuter
A Related Word by Thayer’s/Strong’s Number: from G3189 as noun

This is the root word for ‘melanin’, that which is found in the skin which brings forth the various colors.

Who is the one that writes on the hearts of the living epistles with the ink of the Spirit?  Messiah, who is putting the Mark of God on the foreheads of the righteous.  Notice here that the man with the inkhorn is one among 7…

Eze 9:2  And, behold, six men were coming from the way of the Upper Gate, which faces north. And each had his shattering weapon in his hand. And one man among them was clothed in linen, and an ink horn of a scribe at his loins. And they went in and stood beside the bronze altar.
Eze 9:3  And the glory of the God of Israel had gone on, from on the cherub where it was on it, to the threshold of the house. And He called to the man clothed in linen with the ink horn of a scribe at his loins.
Eze 9:4  And Jehovah said to him, Pass through in the midst of the city, in the midst of Jerusalem, and mark a mark on the foreheads of the men who are groaning and are mourning over all the abominations that are done in her midst.

Here we see an inkhorn instead of a sword.  This links with the armor of God mentioned above as the Word is the Sword of the Spirit. (Ephesians 6:17; Hebrew 4:12).

DNA & Crystal

Liquid Crystalline DNA

DNA is a crystalline structure.  In fact, the double-helical structure of DNA was deduced from crystallographic data.

Single Crystal DNA.  Notice the hexagonal formation…

DNA molecules are modeled as polygonal chains in simple cubic lattices.

Notice the similarity to the skin of a snake.  As mentioned earlier, the word for parchment used in the New Testament (2 Timothy 4:13) is a translation of the Greek word ‘membrane.’  This word can be defined as the ‘skin of a snake.’

‘Jacob’s Ladder’

 The ladder

Gen 28:11  And he came on a place and stayed the night there, for the sun had gone. And he took stones of the place and placed them at his head; and he lay down in that place.
Gen 28:12  And he dreamed. And, behold, a ladder was placed on the earth, its top reaching to the heavens. And, behold, the angels of God were going up and going down on it!

Gen 28:17  And he was afraid, and said, How fearful is this place! This is nothing except the house of God, and this is the door to Heaven.
Gen 28:18  And Jacob started up early in the morning and took the stone which he had placed at his head, and he placed it as a pillar; and he poured oil on the top of it.
Gen 28:19  And he called the name of that place, The House of God
{Bethel}. And yet the name of the city was at first Luz.
The ladder = Messiah

Joh 1:51  And He says to him, Truly, truly, I say to you, From now on you will see Heaven opened, and “the angels of God ascending and descending” on the Son of Man.
Messiah Jesus = the Word
Joh 1:1  In the beginning was the Word, and the Word was with God, and the Word was God.
DNA – Ladder

DNA & Language

DNA is a message from God.  The DNA molecule is just the carrier.  Similar to the Word of God.  The Word of God is the message of God (His character/name)…the scrolls and books on which it is written is the carrier.

This is further seen in the Epigenome.  The Epigenome tells the cell how to ‘translate’ the DNA code.  All of the parts of our bodies have the same genetic code, it is the Epigenome that tells whether the cell is going to be a skin, hair, eye etc cell.  This corresponds to the Holy Spirit.  The Scriptures can be read by anyone yet it is only through the Holy Spirit that one can understand and see the ‘image’ of God .  His Image is not seen through signs and symbols created by man, but only through the Holy Scriptures.

Messiah, who is the Word, is the Image of God.
Heb 1:1  In many ways and in various ways of old, God spoke to the fathers in the prophets;
Heb 1:2  in these last days He spoke to us in the Son, whom He appointed heir of all; through whom He indeed made the ages;
Heb 1:3  who being the shining splendor of His glory, and the express image of His essence, and upholding all things by the Word of His power, having made purification of our sins through Himself, He sat down on the right of the Majesty on high, Psa. 110:1

‘Express image’ in the above verse comes from the following Greek word:

G5481
χαρακτήρ
charaktēr
Thayer Definition:
1) the instrument used for engraving or carving
2) the mark stamped upon that instrument or wrought out on it
2a) a mark or figure burned in (Lev_13:28) or stamped on, an impression
2b) the exact expression (the image) of any person or thing, marked likeness, precise reproduction in every respect, i.e facsimile
Part of Speech: noun masculine
A Related Word by Thayer’s/Strong’s Number: from the same as G5482

As can be seen in Mark of the Beast: The Great Counterfeit part 1, this word traces back to the word for the mark in Revelation 13.  ‘Charaktēr’ comes from ‘charax’ which is used in the Septuagint to translate multiple words, one of which is highly significant in connection with ‘Jacob’s ladder,’ the pillar & image.

charax     H4674    mutstsav

As explained in in Mark of the Beast: The Great Counterfeit part 1, the mark is associated with an image & a garrison.    It was at Bethel (House of God) that Jacob anointed the pillar where the ladder to heaven was seen (Genesis 2812-19).  Jacob’s pillar is connected with the ladder to Heaven.

Messiah applies this to Himself (John 1:51).  The ladder also points to DNA within our bodies which is the ‘word’ that creates our bodies.  Messiah is the Word made flesh who is the olive tree/tree of life which we can be grafted into through faith.  He is the body, we are members of that body through faith.  He is the Temple, we are the stones of the building by faith.

As George Williams puts it: “The gene is a package of information, not an object. The pattern of base pairs in a DNA molecule specifies the gene. But the DNA molecule is the medium, it’s not the message”

The DNA molecule is the instruction manual for the forming of amino acids which are made are the structural elements of proteins that turn into the biochemical units that drive all biological processes.  There are only 22 amino acids found in proteins.  Certain proteins are called enzymes.  They are catalysts (agents that are necessary for a reaction to occur but are not themselves changed in the process); others are called structural proteins which help to build cells and tissues.

If DNA can be thought of as the language of life, then the four bases can be seen as letters and the codons as arrangements of letters, or words. But like English, DNA’s language is more than words. Some codons function as punctuation marks, containing instructions to stop or start manufacturing a protein. This chemically simple yet stunningly complex DNA molecule dictates not only what proteins the organism will be made of, but how these proteins are to be arranged.

We have seen that one codon contains the instructions for one amino acid, and that sequences of codons specify the production of proteins. Groups of codons that have been arranged in “grammatically” correct sentences to form specific proteins are called “genes”.

DNA contains all the information needed to perpetuate life. This information builds in complexity from nucleotides to codons to genes, ultimately giving the complete text to form the body.

The word sign/symbol traces back to the Greek word ‘sememe’ (smallest part of a word) which traces back further to ‘semen’ which means seed in Latin.

The smallest part of a word is called ‘Sememe’ from same root as Semen (seed/DNA).  The root of this word is ‘sem’ which means sign in Greek.  Recall that the Hebrew word for sign is אות ‘ot’ which is also the Hebrew word for letter.

Here we see that language (words) are comparable to signs/symbols and DNA.

Rev 1:1  A Revelation of Jesus Christ, which God gave to Him to show to His slaves things which must occur quickly. And He signified (Greek semaino=signed) by sending through His angel to His slave, John,
Exo 18:20  And you warn them as to the statutes and the laws, and make known (Greek semaino = Hebrew ידע ‘yada’ to know) to them the way in which they should walk, and the work which they should do.

This word ידע ‘yada’ means to know intimately, as in a man ‘knowing’ his wife.  Here we see that the word semaino (sign in Greek) is associated with procreation.  When a man and woman bring forth a child it is through their combination of DNA that the child gets its ‘image.’

Blood (DNA) =image, resemblance

The English word seed traces back to the Hebrew word סוד ‘sod’ which means (mystery/secret).  God’s ‘secret place’ is His Temple (Ezekiel 7:22) which is a picture of Messiah and His body.  The Temple of God is also revealed in our bodies (2 Corinthians 6:16).

Heb 3:14  For we have become partakers* of Christ, if truly we hold the beginning of the assurance firm to the end;
The word partakers here is μέτοχος ‘metochos.’  This is used to translate three words in the Septuagint.  One is בחר ‘bachar’ which means ‘chosen.’  Those who are in Messiah are God’s Chosen.

The second word is חבר ‘chaber.’  This is the word for friend or companion as those who are ‘joined’ to each other.  This is also the word used for the joining together of the Tabernacle which is a picture of the body of Messiah.  The third word used is דמים ‘damim’ which means ‘likeness’ and comes from the above word דם ‘dam’ (blood).

First the natural, then the spiritual

1Co 15:44  It is sown a natural body, it is raised a spiritual body; there is a natural body, and there is a spiritual body.
1Co 15:45  So also it has been written, “The” first “man”, Adam, “became a living soul;” the last Adam a life-giving Spirit.
Gen. 2:7
1Co 15:46  But not the spiritual first, but the natural; afterward the spiritual.
1Co 15:47  The first man was out of earth, earthy. The second Man was the Lord out of Heaven.
Gen. 2:7
1Co 15:48  Such as is the earthy man, such also are the earthy ones. And such as is the heavenly Man, such also are the heavenly ones.
1Co 15:49  And as we bore the image of the earthy man, we shall also bear the image of the heavenly Man.

DNA is a picture of the Word in the natural.  The Tabernacle = our bodies.

2Co 6:16  And what agreement hath the temple of God with idols? for ye are the temple of the living God; as God hath said, I will dwell in them, and walk in them; and I will be their God, and they shall be my people.
1Co 3:16  Know ye not that ye are the temple of God, and that the Spirit of God dwelleth in you?
1Co 3:17  If any man defile the temple of God, him shall God destroy; for the temple of God is holy, which temple ye are.

Joh 2:19  Jesus said to them, Destroy this sanctuary, and in three days I will raise it up.
Joh 2:20  Then the Jews said, This sanctuary was forty six years being built, and do You raise it up in three days?
Joh 2:21  But He spoke about the sanctuary of His body.

The Temple/Tabernacle = the Body
Exo 25:8  And let them make a sanctuary for Me, that I may dwell in their midst.
2Co 6:16  And what agreement hath the temple of God with idols? for ye are the temple of the living God; as God hath said, I will dwell in them, and walk in them; and I will be their God, and they shall be my people.

1Co 3:16  Know ye not that ye are the temple of God, and that the Spirit of God dwelleth in you?

The body = the Tabernacle.  The Holy of Holies =the cell.  The ark of the covenant = the nucleus of the cell.  The Word was placed inside the ark, DNA is inside the nucleus.  Man was created in the image of God (Genesis 1:26-27) .  Specifically, believers in Jesus are created in His image and are now sons of God (1 John 3:1-2; Romans 8:16-23).

Psa 139:16  Your eyes saw my embryo; and in Your book all my members were written the days they were formed, and not one was yet among them.

The Holy of Holies contained the ark of the covenant which had the Word within.  Our cells contain our DNA which is a physical picture of that Word.

The womb is secret…recall that the Temple is God’s ‘secret place’ (Ezekiel 7:22).

Psa 139:15  My bones were not hidden from You when I was made in secret; when I was woven {רקם  ‘râqam’} in the depths of the earth.

רקם  ‘râqam’…this words means fashion, needlework or twisted threads (DNA).

Psa 139:16  Your eyes saw my embryo; and in Your book all my members were written the days they were formed, and not one was yet among them.
Psa 139:17  And how precious are Your thoughts to me, O God! How great is the sum of them!

The Olive tree = His Body = the Pillar/Bethel…

The Root of the Olive Tree = Christ

Rom 11:16  Now if the firstfruit is holy, so also the lump. And if the root is holy, so also the branches.
Isa 6:13  But yet in it shall be a tenth, and it shall return, and shall be eaten: as a teil tree, and as an oak, whose substance {מצבת ‘matstsebeth’ a monumental stone; also the stock of a tree: – pillar, substance.} is in them, when they cast their leaves: so the holy seed(Gal 3:16) shall be the substance (מצבת ‘matstsebeth’) thereof.

Root – מצבת ‘matstsebeth’ – Pillar

Gen 28:10  And Jacob went out from Beersheba, and went toward Haran.
Gen 28:11  And he lighted upon a certain place, and tarried there all night, because the sun was set; and he took of the stones of that place, and put them for his pillows, and lay down in that place to sleep.
Gen 28:12  And he dreamed, and behold a ladder set up on the earth, and the top of it reached to heaven: and behold the angels of God ascending and descending on it.
Gen 28:16  And Jacob awaked out of his sleep, and he said, Surely the LORD is in this place; and I knew it not.
Gen 28:17  And he was afraid, and said, How dreadful is this place! this is none other but the house of God, and this is the gate of heaven.
Gen 28:18  And Jacob rose up early in the morning, and took the stone that he had put for his pillows, and set it up for a pillar
{מצבת ‘matstsebeth’}, and poured oil upon the top of it.
Gen 28:19  And he called the name of that place Bethel {House of God}:: but the name of that city was called Luz at the first.
Gen 28:20  And Jacob vowed a vow, saying, If God will be with me, and will keep me in this way that I go, and will give me bread to eat, and raiment to put on,
Gen 28:21  So that I come again to my father’s house in peace; then shall the LORD be my God:
Gen 28:22  And this stone, which I have set for a pillar, shall be God’s house: and of all that thou shalt give me I will surely give the tenth
{Isaiah 6:13} unto thee.

Gen 35:14  And Jacob set up a pillar(מצבת ‘matstsebeth’) in the place where he talked with him, even a pillar of stone: and he poured a drink offering thereon, and he poured oil thereon.
Gen 35:15  And Jacob called the name of the place where God spake with him, Bethel
{ בּית־אל beytḣ’el house of God}

Mat 16:18  And I say also unto thee, That thou art Peter, and upon this rock I will build my church; and the gates of hell shall not prevail against it.
1Ti 3:15  But if I tarry long, that thou mayest know how thou oughtest to behave thyself in the house of God, which is the church of the living God, the pillar and ground of the truth.

Eph 2:19  Now therefore ye are no more strangers and foreigners, but fellowcitizens with the saints, and of the household of God;
Eph 2:20  And are built upon the foundation of the apostles and prophets, Jesus Christ himself being the chief corner stone;
Eph 2:21  In whom all the building fitly framed together groweth unto an holy temple in the Lord:
Eph 2:22  In whom ye also are builded together for an habitation of God through the Spirit.

Chromosomes

In the egg cell of the woman is 22 autosomes and 1 sex chromosome.  In the sperm cell of the man is 22 autosomes and 1 sex chromosomes.  In order for life to be created, there needs to be 46 chromosomes.

The Holy Scriptures are a combination of the Hebrew and Greek languages.  The Hebrew language consists of 22 letters and the Greek language consists of 24.  The total is 46.

The sperm cell in and of itself cannot produce life and neither can the egg cell of the woman.  These must be combined.   The seed is the Word (Luke 8:11).  The seed is carried by the man.  Here is the picture of the  Letter of law which is dead in and of itself (2 Corinthians 3:6).   It is only when the Spirit (רוח ‘ruach’ in Hebrew is a feminine word) is added to the Word that life is brought forth.

The egg cell is carried by the woman but without the seed (the Word) it does not bring forth life either.  The Hebrew word for egg is בצה ‘betsah’ which traces back to the word for house/temple בית ‘bayit.’  Without the Word in our bodies (temples) we are dead.  We must be born again through the incorruptible seed of the Word of God (1Peter 1:23; Titus 3:5; 1John 3:9; James 1:18).  This is the fruit of the Tree of Life, whose seed is in itself.

Chromosomes are in the shape of an x or cross.  The male carries the X and Y chromosome, the female carries only the X.  The letter X is the Hebrew letter Tav which means a covenant or mark.  The letter Y is the Hebrew letter vav.  Combining these letters we get  תו ‘tav’ which is the Hebrew word for mark. Again the link between genetics and the mark is seen.

Etymology

Chromosome comes from the Greek word ‘khroma’ meaning color/skin and ‘soma’ meaning body.  Chromosomes were given this name because of the ability to be stained underneath a microscope.

In Hebrew this is קרם ‘qaram’ which is a switching for רקם ‘raqam’ which is a word that means ‘twisting of thread‘ (DNA).  קרם ‘qaram’ means a covering as seen in Ezekiel 37:6.

Eze 37:6  and I will put on you sinews and will bring flesh on you and spread {קרם ‘qaram’} skin over you and put breath in you, and you shall live. And you shall know that I am Jehovah.

Ezekiel 37 is an interesting connection to the above discussion on the seed and the egg.  This chapter is speaking of the dry bones which are brought back together but don’t have life until the wind (spirit) is breathed into them.  Bones are from the same word as trees (which makes another interesting connection in the same chapter on the two sticks) which as seen above is linked to the Word.  The Word is ‘dead’ without the Spirit.

Going back to the etymology of chromosome…

Chromosome traces back to the Hebrew word קרם ‘qaram.’  קרם ‘qaram’ means to spread or lay over.  It comes from the root רק which means a ‘gathering of heads/people.’  This word is associated with gatherings of people such as cities, assemblies etc.  It is the word used for a gathering of believers to read the Word and worship the most High… to “קרא ‘qara’” call upon His Name.  This is the root of the word מקרה ‘miqra’ or מקרה קדש ‘miqra qodesh’ speaking of the gatherings at the Sabbaths spoken of in Leviticus 23.  These feasts are commonly referred to as statutes in the Scriptures which comes from the word חק ‘chuq.’  חק ‘chuq’ has an interesting connection to chromosomes.  The word חק ‘chuq’ literally means to divide/separate and then come together.  Interestingly, chromosomes are only visible during the dividing of a cell which in reality is a multiplying of the cell.

Messiah came to divide Israel (Matthew 10:35; Luke 3:7-9) but in reality brought more people unto Himself through the cross (x in the same shape as the chromosome) (John 10:16; 12:32).

1Co 1:18  For the Word of the cross is foolishness to those being lost, but to us being saved, it is the power of God.
1Co 1:23  we, on the other hand, preach Christ crucified (truly an offense to Jews, and foolishness to Greeks),
1Co 1:24  but to the called out ones, both to Jews and to Greeks, Christ is the power of God and the wisdom of God;
Τhe Greek word κρῶμα ‘kroma’ means surface of body, skin, skin color, color and is related to the word grit.  Grit has the meaning of tiny particles of crushed rock or sand {sand is an amazing shadow picture of Messiah & His body}, dust, gravel.  This has interesting parallels in regards to man coming from the dust/earth.  On one level this is speaking of the elements of the earth from whence Adam was made but here it is seen in relation to the chromosomes as well.

“Through studies such as the IGY (International Geophysical Year), we now know that relatively few elements compose most of the earth’s outer crust, including the layers beneath the oceans.  Silicon, oxygen, hydrogen, and aluminum amount for more than 90 percent of the composition of this layers.  Of even greater significance is the discovery that two of those four elements – hydrogen and oxygen – also account for more than 99 percent of our bodies as well!”  {The God Code – Gregg Braden pg 84}

Man is further linked to the earth in the word for man (אדם ‘adam’), and the word for ground (אדמה ‘adamah’).

Adam/adamah comes from the root:


From one blood all mankind comes forth.  In Adam, all the colors of the dust dwelt.

Act 17:26  And He made every nation of men of one blood, to live on all the face of the earth, ordaining fore-appointed seasons and boundaries of their dwelling,
Act 17:27  to seek the Lord, if perhaps they might feel after Him and might find Him, though indeed He not being far from each one of us.
Act 17:28  For in Him we live and move and exist, as also some of the poets among you have said, For we are also His offspring.

In the last Adam (1 Corinthians 15:47), there is no difference in color, race, etc.

Col 3:10  and having put on the new, having been renewed in full knowledge according to the image of the One creating him,
Col 3:11  where there is no Greek and Jew, circumcision and uncircumcision, foreigner, Scythian, slave or freeman, but Christ is all things and in all.
Col 3:12  Therefore, as elect ones of God, holy and beloved, put on a heart of compassions, kindness, humility, meekness, long-suffering,

Rom 10:12  For there is no difference both of Jew and of Greek, for the same Lord of all is rich toward all the ones calling on Him.
Gal 3:26  for you are all sons of God through faith in Christ Jesus.
Gal 3:27  For as many as were baptized into Christ, you put on Christ.
Gal 3:28  There cannot be Jew nor Greek, there is no slave nor freeman, there is no male and female; for you are all one in Christ Jesus.
Gal 3:29  And if you are of Christ, then you are a seed of Abraham, even heirs according to promise.

Interestingly, the word for color in Hebrew is צבע ‘tseva,’ which has a similar meaning as טבל ‘tevel,’ the word for baptism.  To dip the finger (especially in blood) to color something.

4 Skin colors – 4 Soil Colors

The four skin tones, pink, yellow, olive and brown, correspond to the 4 colors found in soil.  Soil is found in white, red, yellow and brown colors.

Adam, who came from the ground (adamah) was the father of all mankind.  Later this was replayed in Noah.

Gen 9:18  And the sons of Noah that went out of the ark were Shem, Ham, and Japheth. And Ham is the father of Canaan.
Gen 9:19  These are the three sons of Noah, and the whole earth was overspread from them.

Gen 9:20  And Noah, a man of the ground (adamah), began and planted a vineyard.
From Shem, Ham and Japheth the world was overspread/scattered into 70 nations (Genesis 10).  These 70 nations were divided according to the children of Israel (Deuteronomy 32:8).

Deu 32:8  when the Most High divided to the nations their inheritance; when He separated the sons of Adam, He set up the bounds of the peoples, according to the number of the sons of Israel.
Amazingly, the taxonomy of soil divides the types of dirt into twelve.

Alfisols, Andisols, Aridsols, Entisols, Gelisols, Histosols, Inceptisols, Mollisols, Oxisols, Spodosols, Ultisols, Vertisols.

Israel is a coat of many colors personified by the coat of Joseph.
Gen 37:3  Now Israel loved Joseph more than all his children, because he was the son of his old age: and he made him a coat of many colours.
colours:  Kethoneth passim, a coat made of stripes of different coloured cloth.

The Scriptures, as well as tradition speaks of Israel having different shades of skin color.

Genesis Rabah 98:5 says that Simeon and Levi were light colored types
Mishna Negaim 2:1 says that Israelites (in this case Jews of Judah) are mainly of an intermediate type color being neither black (Cushi) or white (Germani)
Genesis Rabah 86:3 says that Joseph was Germani Talmud Sota 36 describes him as having a face like a pink rose
Esau was ruddy/red/blonde Gen 25:25 as was David 1 Samuel 16:2
Laban means white or blonde
The Shepherdess in Song of Solomon was black and comely Son 1:6

Interestingly, color further connects to Israel in the numbers of 7 and 12.  There are 7 colors in the color spectrum which corresponds to the 7 branches of the Menorah.  The Menorah is a picture of the body of Messiah{Revelation 1:20; John 15:5}.  The 7 colors then expand into 12 color hues of the color wheel.

Biblically, race is not defined by color.  Race is defined by what nature you are.  You are either in Messiah or you are not.  You are either for Him or against Him.  You are either the seed of the woman or the seed of the serpent.  As seen above, the word for color in Hebrew has the same meaning as being baptised and becoming anew.  You are either sprinkled by the blood of Messiah (Isaiah 52:15; Hebrew 10:22) or you are still covered in the garments of sinful flesh.

1Pe 2:9  But you are “an elect race,” “a royal priesthood,” “a holy nation,” “a people for possession,” so that “you may openly speak of the virtues” of the One who has called you out of darkness into His marvelous light; LXX-Ex. 23:22; MT-Ex. 19:5, 6

In Hebrew the word for race is גזע ‘geza,’ which means the stock/root of a tree.

H1503
גּזע
geza‛
BDB Definition:
1) stem, trunk, stock (of trees)

Who is the root of Israel?  Messiah Jesus.
Rom 11:16  For if the firstfruit (1Cor 15:52 -Messiah) be holy, the lump is also holy: and if the root (Isa 6:13; Gal 3:16 – Messiah) be holy, so are the branches (Joh 15:5).
Isa 11:1  And there shall come forth a rod out of the stem (H1503  גּזע geza‛) of Jesse, and a Branch{H5342 נצר netser} shall grow (parah -bear fruit) out of his roots:

נצר netser is the origin of the name ‘Christian’.Netsarim

The second part of the word ‘chromosome’ comes from the Greek word soma, σῶμα, which means body and is used in various applications (body of man, animals, planets, society, church, etc.).  This traces back to multiple Hebrew words which are significant to the current study.  In Exodus 24:10 the word body is translated from the Hebrew word עצם ‘etsem’ which is the word for bone coming from the root עץ ‘ets’ meaning a tree.  The connection to the Tree of Life is obvious.

In Judges 8:30 the Hebrew word ירך ‘yarekh’ is translated as body.  ירך ‘yarekh’has the meaning of a shaft as seen in the main trunk of the Menorah in the Temple.  This is yet another picture of the Tree of Life and the Messiah.

Here then we see the picture of the chromosome being a gathering of people to form a body.  The chromosome is the ‘body’ which holds the DNA which consists of the individual parts which make up the whole.  The body of Messiah works the same way.  Each individual has a particular purpose to fulfill the whole.  This is pictured in the Tabernacle whose individual parts combined to make ONE building (Exodus 36:13).  This is seen in the Word which contains many different letters and words to make ONE message.

The Cross

The chromosome is seen in the image of the cross.  It is the mark that the LORD places on His faithful believers (Ezekiel 9:4).   The chromosome represents the gathering of people to form a body, the cross of Messiah does the same.

It is through the work of Messiah on the cross that mankind is brought into His family.

Isa 40:10  Behold, the Lord GOD will come with strong hand, and his arm shall rule for him: behold, his reward is with him, and his work before him.
Isa 40:11  He shall feed his flock like a shepherd: he shall gather the lambs with his arm, and carry them in his bosom, and shall gently lead those that are with young.

Psa 89:50  Remember, Lord, the reproach of thy servants; how I do bear in my bosom the reproach of all the mighty people;
Psa 89:51  Wherewith thine enemies have reproached, O LORD; wherewith they have reproached the footsteps of thine anointed.

Eph 2:8  For by grace are ye saved through faith; and that not of yourselves: it is the gift of God:
Eph 2:9  Not of works, lest any man should boast.
Eph 2:10  For we are his workmanship, created in Christ Jesus unto good works, which God hath before ordained that we should walk in them.
Eph 2:11  Wherefore remember, that ye being in time past Gentiles in the flesh, who are called Uncircumcision by that which is called the Circumcision in the flesh made by hands;
Eph 2:12  That at that time ye were without Christ, being aliens from the commonwealth of Israel, and strangers from the covenants of promise, having no hope, and without God in the world:
Eph 2:13  But now in Christ Jesus ye who sometimes were far off are made nigh by the blood of Christ.
Eph 2:14  For he is our peace, who hath made both one, and hath broken down the middle wall of partition between us;
Eph 2:15  Having abolished in his flesh the enmity, even the law of commandments contained in ordinances; for to make in himself of twain one new man, so making peace;
Eph 2:16  And that he might reconcile both unto God in one body by the cross, having slain the enmity thereby:
Eph 2:17  And came and preached peace to you which were afar off, and to them that were nigh.
Eph 2:18  For through him we both have access by one Spirit unto the Father.
Eph 2:19  Now therefore ye are no more strangers and foreigners, but fellowcitizens with the saints, and of the household of God;


Unity comes only through Messiah and the New Covenant in Him (Psalm 50:5; Isaiah 49:3-9; Hebrews 13:20-21; Jeremiah 50:5; Ephesians 2:15; Colossians 1:20; 2:1-11) and walking with Him (1John 1:3-7).

“Unity in the body of Christ does not rest on uniformity, but on our common ‘blood,’ which is the blood of Christ.  We are now members of one family, and that identity cannot be taken from us, no matter how much we disagree or quarrel.” (The Gospel in Human Contexts – Paul Hiebert pg 193)

Cell

The DNA molecule resides in the nucleus of our cells.  Each cell in our bodies is a picture of the Tabernacle/Temple of God with the nucleus representing the Holy Place.  The DNA in the nucleus of the cell is pictured by the Torah in/beside the ark of the covenant.

The English word ‘cell’ traces back to the Hebrew word כל ‘kal’ which means to complete.  This is also the root of the word כלה ‘kalah’ which means a bride.  The cell is a picture of the Tabernacle/Body of Messiah/bride.

The Hebrew word for cell is תא ‘ta’ (Eze 40:7 chamber)

תא Tav aleph is related to the word tav תו  (tav= cross…chromosome) and aleph tav את and means a mark/boundary.

תא tav aleph relates to the word tar תר which means the ‘mark of man’ or the border/outline.

From this root we get ta’ar and to’ar.  These words mean form, outline or border.  This is an important connection to see in that the mark of the beast versus the mark of God ultimately reflects whose image/form you are in.

This connection between the mark and the image/form/outline/shadow picture of the LORD Jesus versus the antichrist is further seen in that the word Torah comes from this same root.

We can have the mark of God and be in His image by walking in His Word and Messiah living through us (Galatians 2:20), or we can have the mark of the beast and be in the image of satan by walking in his “torah” which is lawlessness (Ephesians 2:2-3Isaiah 30:8-11; 1 Peter 2:8).

We can choose the tree of life or the tree of knowledge.  The Light of the Word or the false light which is in reality darkness (Matthew 6:23).

Cells, bride & bread…
As seen in ‘Shadows of Messiah – Alphabet‘ the Hebrew Aleph Bet is likened unto manna/bread.

Bread is linked to the mark (Exodus 13:9; 1 Corinthians 5:7-Exodus 12:13).

א-ת = Completion

Col 2:9  For in him dwelleth all the fulness of the Godhead bodily.
Col 2:10  And ye are complete in him, which is the head of all principality and power:

Wisdom in the Hebrew Alphabet pg 34

“Comprising the first and last letter of the Aleph Beis, את alludes to completion and perfection.  Thus the Torah uses the emphatic article in describing the beginning of Creation:”

“This usage alludes to the fact that the universe was created in complete perfection, ‘from aleph to tav.’ “  {Wisdom in the Hebrew Alphabet}

Wisdom in the Hebrew Alphabet pg 35

Manna = Aleph Tav?

Wisdom in the Hebrew Alphabet pg 37
Wisdom in the Hebrew Alphabet pg 37

Who is the manna?
Joh 6:30  Then they said to Him, Then what miraculous sign do You do that we may see and may believe You? What do You work?
Joh 6:31  Our fathers ate the manna in the wilderness, as it is written “He gave them bread out of Heaven to eat.”
LXX-Psa. 77:24; MT-Psa. 78:24
Joh 6:32  Then Jesus said to them, Truly, truly, I say to you, Moses has not given you the bread out of Heaven, but My Father gives you the true bread out of Heaven.
Joh 6:33  For the bread of God is He coming down out of Heaven and giving life to the world.
Joh 6:34  Then they said to Him, Lord, always give us this bread.
Joh 6:35  Jesus said to them, I am the Bread of life; the one coming to Me will not at all hunger, and the one believing into Me will not thirst, never!
Joh 6:36  But I said to you that you also have seen Me and did not believe.
Joh 6:37  All that the Father gives to Me shall come to Me, and the one coming to Me I will in no way cast out.
Joh 6:38  For I have come down out of Heaven, not that I should do My will, but the will of Him who sent Me.
Joh 6:39  And this is the will of the Father sending Me, that of all that He has given Me, I shall not lose any of it, but shall raise it up in the last day.
Joh 6:40  And this is the will of the One sending Me, that everyone seeing the Son and believing into Him should have everlasting life; and I will raise him up at the last day.
Joh 6:41  Then the Jews murmured about Him, because He said, I am the Bread coming down out of Heaven.
Joh 6:42  And they said, Is this not Jesus the son of Joseph, of whom we know the father and the mother? How does this One now say, I have come down out of Heaven?
Joh 6:43  Then Jesus answered and said to them, Do not murmur with one another.
Joh 6:44  No one is able to come to Me unless the Father who sent Me draws him, and I will raise him up in the last day.
Joh 6:45  It has been written in the Prophets, They “shall” all “be taught of God.” So then everyone who hears and learns from the Father comes to Me;
Isa. 54:13
Joh 6:46  not that anyone has seen the Father, except the One being from God, He has seen the Father.
Joh 6:47  Truly, truly, I say to you, The one believing into Me has everlasting life.
Joh 6:48  I am the Bread of life.
Joh 6:49  Your fathers ate the manna in the wilderness and died.
Joh 6:50  This is the Bread coming down out of Heaven, that anyone may eat of it and not die.
Joh 6:51  I am the Living Bread that came down from Heaven. If anyone eats of this Bread, he will live forever. And indeed the bread which I will give is My flesh, which I will give for the life of the world.
Joh 6:52  Then the Jews argued with one another, saying, How can this One give us his flesh to eat?
Joh 6:53  Then Jesus said to them, Truly, truly, I say to you, Except you eat the flesh of the Son of Man, and drink His blood, you do not have life in yourselves.
Joh 6:54  The one partaking of My flesh and drinking of My blood has everlasting life, and I will raise him up at the last day.
Joh 6:55  For My flesh is truly food, and My blood is truly drink.
Joh 6:56  The one partaking of My flesh and drinking of My blood abides in Me, and I in him.
Joh 6:57  Even as the living Father sent Me, and I live through the Father; also the one partaking Me, even that one will live through Me.
Joh 6:58  This is the Bread which came down out of Heaven, not as your fathers ate the manna and died; the one partaking of this Bread will live forever.
Joh 6:59  He said these things teaching in a synagogue in Capernaum.
Joh 6:60  Then many of His disciples having heard, they said, This Word is hard; who is able to hear it?
Joh 6:61  But knowing in Himself that His disciples were murmuring about this, Jesus said to them, Does this offend you?
Joh 6:62  Then what if you see the Son of Man going up where He was at first?
Joh 6:63  It is the Spirit that gives life. The flesh does not profit, nothing! The Words which I speak to you are spirit and are life.

Exo 16:4  And Eph 2:8  For by grace are ye saved through faith; and that not of yourselves: it is the gift of God:
Eph 2:9  Not of works, lest any man should boast.
Eph 2:10  For we are his workmanship, created in Christ Jesus unto good works, which God hath before ordained that we should walk in them.
Eph 2:11  Wherefore remember, that ye being in time past Gentiles in the flesh, who are called Uncircumcision by that which is called the Circumcision in the flesh made by hands;
Eph 2:12  That at that time ye were without Christ, being aliens from the commonwealth of Israel, and strangers from the covenants of promise, having no hope, and without God in the world:
Eph 2:13  But now in Christ Jesus ye who sometimes were far off are made nigh by the blood of Christ.
Eph 2:14  For he is our peace, who hath made both one, and hath broken down the middle wall of partition between us;
Eph 2:15  Having abolished in his flesh the enmity, even the law of commandments contained in ordinances; for to make in himself of twain one new man, so making peace;
Eph 2:16  And that he might reconcile both unto God in one body by the cross, having slain the enmity thereby:
Eph 2:17  And came and preached peace to you which were afar off, and to them that were nigh.
Eph 2:18  For through him we both have access by one Spirit unto the Father.
Eph 2:19  Now therefore ye are no more strangers and foreigners, but fellowcitizens with the saints, and of the household of God;
said to Moses, Behold, I AM! Bread will rain from the heavens for you. And the people shall go out and gather the matter of a day in its day, so that I may test them, whether they will walk in My Law or not.

The matter of a day in its day ‘davar-yom b’yom’

Exo 16:4  ויאמר יהוה אל־משׁה הנני ממטיר לכם לחם מן־השׁמים ויצא העם ולקטו דבר־יום ביומו למען אנסנו הילך בתורתי אם־לא׃

Bread= The Word

Psa 102:4  My heart is stricken and dried like grass, so that I forget to eat my bread.
TARGUM
5.     My heart is smitten like grass and will dry up; for I have forgotten the Torah of my instruction.
Deu 8:3  And He has humbled you, and caused you to hunger, and caused you to eat the manna, which you had not known, and your fathers had not known, in order to cause you to know that man shall not live by bread alone, but man shall live by every Word that proceeds from the mouth of Jehovah.
Mat 4:2  And having fasted forty days and forty nights, afterwards He hungered.
Mat 4:3  And coming near to Him, the Tempter said, If You are the Son of God, speak that these stones may become loaves.
Mat 4:4  But answering, He said, It has been written: “Man shall not live by bread alone, but on every Word going out of the mouth of God.”

Table of Shewbread (Exo 25:30)

Shew-bread – לחם פנים  lechem panim literally, bread of faces

His Face (paniym) = Jesus

Psa 42:5  O my soul, why are you cast down and moan within me? Hope in God, for I shall yet thank Him for the salvation (yeshuah) of His presence (paniym).

His Face = His Image
Heb 1:3  who being the shining splendor of His glory, and the express image of His essence, and upholding all things by the Word of His power, having made purification of our sins through Himself, He sat down on the right of the Majesty on high, Psa. 110:1
Psa 17:15  As for me, in righteousness I will look upon Your face; when I awaken, I shall be satisfied by Your image.
The Table

Apostle=shalach from the same root as Table.  Apostles take for the Bread of Life to the world.

Isa 52:7  How beautiful on the mountains are the feet of him proclaiming good news, making peace heard, bearing tidings of good, making heard salvation, saying to Zion, Your God reigns.
Joh 4:32  But He said to them, I have food to eat which you do not know.
Joh 4:33  Then the disciples said to one another, No one brought Him food to eat?
Joh 4:34  Jesus said to them, My food is that I should do the will of Him who sent Me, and that I may finish His work.
Joh 6:51  I am the Living Bread that came down from Heaven. If anyone eats of this Bread, he will live forever. And indeed the bread which I will give is My flesh, which I will give for the life of the world.

Bread=His flesh=Basar



Mat 4:4  But answering, He said, It has been written: “Man shall not live by bread alone, but on every Word going out of the mouth of God.”
Deut. 8:3
Mat 6:11  Give us today our daily bread,
Deu 8:3  And He has humbled you, and caused you to hunger, and caused you to eat the manna, which you had not known, and your fathers had not known, in order to cause you to know that man shall not live by bread alone, but man shall live by every Word that proceeds* from the mouth of Jehovah.
H4161*
môtsâ’ מצא  /  מוצא

This is related to the Hebrew word for unleavened bread

H4682
matstsâh
BDB Definition:
1) unleavened (bread, cake), without leaven. מצּה

Unleavened Bread is a picture of Messiah.  Matsa is pierced, bruised and striped which points back to Isaiah 53, where the Right Arm of God is revealed.  The Right Arm of God= the Light of His Face (lechem paniym)

Psa 44:3  For they did not inherit the land with their own sword; yea, their own arm did not save them. But it was Your right hand and Your arm and the light of Your face, because You favored them.

Bread=His Flesh=Gospel

Basar Gospel Flesh

Man was made in the image of God (Genesis1:26)…Messiah is the Image of God (Hebrews 1:3; 2 Corinthians 4:4), hence when we look at the human body it points to Messiah.  The body as a whole, and each individual body part speaks the Gospel.

The Gospel is connected w/flesh. Where is the first reference to flesh? The union of Adam and Eve…a picture of Jesus and His Bride becoming one is  the fulfillment of the Good News.

Gen 2:21  And Jehovah God caused a deep sleep to fall on the man, and he slept. And He took one of his ribs, and closed up the flesh underneath.
Gen 2:22  And Jehovah God formed the rib which He had taken from the man into a woman, and brought her to the man.
Gen 2:23  And the man said, This now at last is bone from my bones, and flesh from my flesh. For this shall be called Woman, because this has been taken out of man.
Gen 2:24  Therefore, a man shall leave his father and his mother, and shall cleave to his wife and they shall become one flesh
Eph 5:30  For we are members of His body, of His flesh, and of His bones.
Eph 5:31  “For this, a man shall leave his father and mother, and shall be joined to his wife, and the two shall be one flesh.” Gen. 2:24
Eph 5:32  The mystery is great, but I speak as to Christ and as to the assembly.

The rib of Adam from whence his bride came out is linked to the number 5 which connects to the 5th day of creation and life.

חמש ‘chamesh’ is used to translate multiple terms in Hebrew.  It is used for the number five/fifty, the hand, to be armed and the side of the body (fifth rib).

The ‘fifth rib’
H2570
חמשׁ
chômesh
This word is used in the following verses:
fifth, 4
2Sa_2:23, 2Sa_3:27, 2Sa_4:6, 2Sa_20:10

Messiah was wounded in the side (‘the fifth rib’).
Joh 19:34  But one of the soldiers pierced His side with a lance, and at once blood and water came out.
Adam’s bride came forth from his rib/side (Genesis 2:22) which is a picture of Messiah’s bride ‘coming forth’ when He offered Himself as an atonement to bring us back to God.  Interestingly, the year of Jubilee, which occurs every 50 (chamashim) years (Leviticus 25:10-13) began on the Day of Atonement.  The great trumpet (Isaiah 27:13) will be blown and those resurrected in the 1st resurrection will receive their inheritance in the land.  This is interesting because the shofar is in the Fibonacci sequence which the pattern the Most High uses in His creation of life.  The Fibonacci sequence is encoded with the number 5.  Even more interesting is that shofars are shaped like a single strand of DNA.  If one looks at a shofar and superimposes another one on top of it, the DNA molecule is seen.

Further linking DNA with the shofar is that fact that the shofar is likened unto the voice of the Word (Revelation 1:10-11; Isaiah 27:13; John 5:25; 11:43; 1 Thessalonians 4:13).

Our ears are based upon the Fibonacci pattern:

Interestingly, hearing is linked to the mark through the ‘shema’ (Deuteronomy 6:4-9).

Rom 10:16  But not all obeyed the gospel, for Isaiah says, “Lord, who has believed our report?” Isa. 53:1
Rom 10:17  Then faith is of hearing, and hearing through the Word of God.
Rom 10:18  But I say, Did they not hear? Yes, rather, “into all the earth their voice went out, and to the ends of the world their words.”
LXX-Psa. 18:5; MT-Psa. 19:4

Their voice went out.  What is the voice of the Word/Jesus likened to?  A Shofar (Revelation 1:10-11), which is in the Fibonacci pattern.

The connection here to sound is significant as more and more research is pointing to the connection between sound and our DNA.  This is not surprising as sound and the Word is intimately linked in the Word.  All of creation comes forth from the Word/sound (Psalm 33:6).  The giving of the 10 commandments and man hearing the voice of God was seen at Mt. Sinai where the shofar blew louder and louder.

It is His Voice/Word that brings Life.

Isa 27:13  And it shall be in that day, the great ram’s horn shall be blown; and those perishing in the land of Assyria and the outcasts in the land of Egypt shall come and shall worship Jehovah in the holy mountain in Jerusalem.
Joh 5:25  Truly, truly, I say to you that an hour is coming, and now is, when the dead will hear the voice of the Son of God, and the ones hearing will live.
Joh 5:28  Do not marvel at this, for an hour is coming in which all those in the tombs will hear His voice.
Joh 5:29  And they will come out, the ones having done good into a resurrection of life; and the ones having practiced evil into a resurrection of judgment.
Joh 11:43  And saying these things, He cried out with a loud voice, Lazarus! Here! Outside!
1Th 4:16  Because the Lord Himself shall come down from Heaven with a commanding shout of an archangel’s voice, and with God’s trumpet. And the dead in Christ will rise again first.
Mat 24:31  And He will send His angels with a great sound of a trumpet, and they will gather His elect from the four winds, from the ends of the heavens to their ends.
1Co 15:52  In a moment, in a glance of an eye, at the last trumpet; for a trumpet will sound, and the dead will be raised incorruptible, and we shall all be changed.


The Voice of Jesus brings back the exiles.  This is significant as it will be seen that the message of the Gospel given to the Apostles is likened to bread from the Table of showbread, as they are made ‘fishers’ of men.

Joh 10:3  The doorkeeper opens to him, and the sheep hear his voice, and he calls his own sheep by name, and leads them out.
Joh 10:16  And I have other sheep which are not of this fold. I must also lead those, and they will hear My voice; and there will be one flock, one Shepherd.
Joh 10:27  My sheep hear My voice, and I know them, and they follow Me.
Joh 10:28  And I give eternal life to them, and they shall not perish to the age, never! And not anyone shall pluck them out of My hand.
Jer 31:6  For there shall be a day when the watchmen on Ephraim’s hills shall call out, Arise and let us go up to Zion, to Jehovah our God.
Jer 31:7  For so says Jehovah, Sing with gladness for Jacob, and shout among the head of the nations. Cry out, give praise and say, O Jehovah save Your people, the remnant of Israel.
Jer 31:8  Behold! I will bring them from the north country, and gather them from the recesses of the earth. Among them the blind, and the lame, the pregnant one, and the travailing one together, a great company shall return here.
Jer 31:9  They shall come with weeping, and I will lead them with prayers. I will cause them to walk by rivers of waters, in a right way; they will not stumble in it. For I am a father to Israel, and Ephraim is My first-born.
Jer 31:10  Hear the Word of Jehovah, O nations, and declare in the coastlands far away, and say, He who scattered Israel will gather him and keep him, as a shepherd his flock.
Bread of His presence, the Showbread

Jesus is His ‘paniym’ (presence, face)
Psa 42:5  O my soul, why are you cast down and moan within me? Hope in God, for I shall yet thank Him for the salvation of His presence.


Psa 44:3  For they did not inherit the land with their own sword; yea, their own arm did not save them. But it was Your right hand
(Messiah- Exo 15) and Your arm (Messiah Isa 53) and the light of Your face, because You favored them.


Interestingly the arm and hand are in the Fibonacci pattern.

The Light of His Face is linked with the sound of the Shofar

Psa 89:15  Blessed is the people knowing the joyful sound; O Jehovah, they shall walk in the light of Your face.
What is the joyful sound?  The sound of the Shofar & Trumpets.
Psa 98:5  Sing praise to Jehovah with the lyre; with the lyre and the voice of a song.
Psa 98:6  With trumpets and the sound of a horn, make a joyful noise before Jehovah the King.
The sound of the trumpets = the sound of His Word.
Num 10:2  Make two trumpets of silver for yourself. You shall make them of hammered work, and they shall be to you for the calling of the congregation, and for causing the camps to pull up stakes.
Psa 12:6  The Words of Jehovah are pure Words, like silver refined in an earthen furnace, purified seven times.
The bread of the Presence sat upon a table.  The Hebrew word for table is שלחן ‘shulchan’ coming from the root שלח ‘shalach’ meaning to send out, as in one sending out his hand to the table to receive food (life).  This is the concept of an Apostle (שליח ‘sholiach’), one who sends forth a message of good news (בסר ‘basar’ – meat/gospel).

The first use of the word שלח  ‘shalach’ is seen in Genesis 3:23 where Adam was expelled from the Garden due to the sin of eating from the tree of knowledge.

Gen 3:23 Jehovah God sent him out of the garden of Eden to till the ground out of which he was taken.
Adam was to work the ground from whence he was taken. Adam, who partook of the tree of knowledge which brings death, sent forth שלח ‘shalach’ his message to the world (1 Corinthians 15:22). The bread that comes forth from the earth brings temporal life but cannot deliver from death. The message of Messiah comes forth from the Tree of Life. It is the bread from heaven that brings life to the world.

Apostles take for the Bread of Life to the world

Isa 52:7  How beautiful on the mountains are the feet* of him proclaiming good news, making peace heard, bearing tidings of good (basar), making heard salvation (Heb. yeshua), saying to Zion, Your God reigns.
*The feet are in the pattern of the Fibonacci sequence.

Joh 4:32  But He said to them, I have food to eat which you do not know.
Joh 4:33  Then the disciples said to one another, No one brought Him food to eat?
Joh 4:34  Jesus said to them, My food is that I should do the will of Him who sent Me, and that I may finish His work.
Joh 6:51  I am the Living Bread that came down from Heaven. If anyone eats of this Bread, he will live forever. And indeed the bread which I will give is My flesh, which I will give for the life of the world.
Going back to the connection between the gospel (basar) and Adam & Eve…

The word for bride is:

This comes from the root כל ‘kol’ which is related to the belly (חי chay-life):

The Hebrew word for food comes from this same root:

The English word cell comes from this Hebrew root.  The human cell is designed just as the Tabernacle/Temple.  DNA, in the nucleus of the cell is the blueprint for life & the flesh.  It corresponds to the 10 commandments and the Torah in the Holy of Holies of the Tabernacle.  DNA is formed in the Fibonacci pattern.

Cell -early 12c., “small room,” from L. cella “small room, store room, hut,” related to L. celare “to hide, conceal,” from PIE base *kel- “conceal”

The word cell traces back to the Latin ‘cella’ and then to the Hebrew word ‘kol’ כל.    Kaf is the 11th letter of the Hebrew alphabet and Lamed is the 12th.  Combined this makes 23, corresponding to the 23 chromosomes in the human body where the DNA is stored.

http://www.icr.org/article/shapes-numbers-patterns-divine-proportion-gods-cre/
“When we realize that the information to produce these spirals and numbers in living things is stored in the DNA, should we then be surprised to find that the DNA molecule is 21 angstroms in width and the length of one full turn in its spiral is 34 angstroms, both Fibonacci numbers? The DNA molecule is literally one long stack of golden rectangles.”

The DNA spiral is a Golden Section

The DNA molecule, the program for all life, is based on the golden section.  It measures 34 angstroms long by 21 angstroms wide for each full cycle of its double helix spiral.
34 and 21, of course, are numbers in the Fibonacci series and their ratio, 1.6190476 closely approximates phi, 1.6180339.

B-DNA has spirals in phi proportions

DNA in the cell appears as a double-stranded helix referred to as B-DNA.

This form of DNA has a two groove in its spirals, with a ratio of phi in the proportion of the major groove to the minor groove, or roughly 21 angstroms to 13 angstroms.

The Hebrew word for Temple (הכל ‘heykal’) comes from the same root as cell, food and bride (כל ‘kol’).

This corresponds perfectly to the Temple/Tabernacle of God and the word cell means hidden.

Eze 7:22  I also will turn My face from them, and they shall defile My hidden place. And violent ones shall enter into it and defile it.
Our bodies are His Temple (Ephesians 2:21-22; 5:30; 1 Corinthians 6:19) which are intimately linked to the Fibonacci sequence & the number 5 (the 5th day).

‘Junk DNA’

There are approximately 3 billion letters in the human genome, only 1% code for protein (DNA Interactive-www.dnai.org).  Most of the DNA molecule is referred to as ‘junk DNA’ that is supposedly an unneeded remnant from our evolutionary past.  This, of course, is 100% fallacious.
Even though ‘junk DNA’ doesn’t make proteins, it still functions in the same manner as the 1% that does.  The ‘junk DNA’ is known as ‘introns.’  Introns are called non-coding DNA because they are not used to form proteins.  However, they still work in the same way as language even forming palindromes and maintaining the symmetry between complementary strands.  Using the Zipf law, scientists have found that non-coding DNA is similar to human languages.

Zipf Law

Language in junk DNA – Karl Kruszelnicki

“According to the linguists, all human languages obey Zipf’s Law. It’s a really weird law, but it’s not that hard to understand. Start off by getting a big fat book. Then, count the number of times each word appears in that book. You might find that the number one most popular word is “the” (which appears 2,000 times), followed by the second most popular word “a” (which appears 1,800 times), and so on. Right down at the bottom of the list, you have the least popular word, which might be “elephant”, and which appears just once.

Set up two columns of numbers. One column is the order of popularity of the words, running from “1″ for “the”, and “2″ for “a”, right down “1,000″ for “elephant”. The other column counts how many times each word appeared, starting off with 2,000 appearances of “the”, then 1,800 appearances of “a”, down to one appearance of “elephant”.

If you then plot on the right kind of graph paper, the order of popularity of the words, against the number of times each word appears you get a straight line! Even more amazingly, this straight line appears for every human language – whether it’s English or Egyptian, Eskimo or Chinese! Now the DNA is just one continuous ladder of squillions of rungs, and is not neatly broken up into individual words (like a book).

So the scientists looked at a very long bit of DNA, and made artificial words by breaking up the DNA into “words” each 3 rungs long. And then they tried it again for “words” 4 rungs long, 5 rungs long, and so on up to 8 rungs long. They then analysed all these words, and to their surprise, they got the same sort of Zipf Law/straight-line-graph for the human DNA (which is mostly introns), as they did for the human languages!

There seems to be some sort of language buried in the so-called junk DNA!”

Dr. Len Horowitz has found that the primary function of DNA may not be the formation of proteins but as a ‘spiritual antennae’ to the Creator.

Spiritual Science – DNA is influenced by Words and Frequencies:
DNA Can Be Influenced And Reprogrammed By Words And Frequencies Russian DNA Discoveries

“More than a map of life, DNA processes spirituality according to the latest research. A lengthy review of scientific achievements in the field of genetics compiled by a team of experts indicates that life evolved from spiritual, more than physical, forces.

Three years of multidisciplinary study by a team of health science, mathematics, genetics, and physics experts, indicates that DNA, traditionally considered the “blueprint of life,” appears more like an “antennae to God.” Led by internationally known public health authority and award winning author, Dr. Leonard Horowitz, the group’s research, to be published in October, shows that DNA’s coiled design, vibrating action, and “electrogenetic” function makes spiritual as well as physical evolution possible.

Life’s genomes are empowered by waves and particles of energized sound and light which, more than chemicals or drugs, switch genes “on” or “off.” Likewise, genetic inheritance is energetically transmitted “bioacoustically and electromagnetically” through special water molecules that form the electrogenetic matrix of the “Sacred Spiral.” These hydroelectric geometric structures—most shaped like pyramids, hexagons, and pentagons—direct physical as well as spiritual development, according to researchers.”

The Menorah is linked to the Solfeggio scale through a spiraling movement, also linking it to the DNA helix:

The Menorah and the Solfeggio Scale

Identity – You are the Tabernacle of God by John Saba pg 54

Day 1 of creation corresponds to day 4.  Day 2 corresponds to day 5.  Day 3 corresponds to day 6.  The Light of the 1st day connects with the light of the sun on day 4.  The fish in the 5th day and the water of the 2nd day connect.  Man in the 6th day connects with the earth/dust from whence he came.  Using this pattern Mr. Saba found that the menorah shows the original Solfeggio scale Solfeggio Scale .

Left to right
174, 285, 396
Right to left
417, 528, 639
Bottom to right to left
741, 852, 963
1: Ut=396=9
2. Re=417=3
3. Mi=528=6
4. Fa=639=9
5. Sol=741=3
6. La=852=6

By following the above, 174, 285, 396 etc, a spiral movement is seen.  Here we see a connection, via the Menorah, between light and sound.  The 7 branches of the Menorah correspond to the 7 notes in the musical scale and the 7 colors in the color spectrum and the 7 wavelengths of the electromagnetic spectrum.

As seen in Shadows of Messiah – Mathematics, all of creation is based upon frequencies which are numbers.  Marko Rodin discovered what has come to be known as vortex based mathematics which is based upon the same 3, 6, 9 pattern of the Solfeggio scale.  The significant part of Rodin’s discoveries is that DNA fits into this same pattern.

Digging deeper, Stan Tenen (meru.org)  has found even more connections between Vortex based mathematics and DNA.

“The 3,10 knot is defined by a braided column of 99 tetrahedra.  [Each column of 99 tetrahedra represents 3 turns in the knot].  Each of the 3 turns in the knot is represented by a column segment of 33 tetrahedra. Each segment of 33 tetrahedra has 4×33 = 132 faces, of which 132/2 = 66 are internal and 132/2 =66 are external. The 66 external faces form 3 strings of 22 faces each, and each string corresponds to the 22 Hebrew letters.”

66 of course, corresponds to the number of books in the Bible.

The Menorah is a picture of the Word.

The Bible Wheel

“The 66 books of the Bible are spiraled into 3 cycles, encompassed by the 22 Hebrew letters, which then beautifully manifests the 7  divisions of the Biblical Canon”.

“The Bible Wheel is a circular presentation of the Bible that I discovered by rolling up the traditional list of the sixty-six books like a scroll on a spindle wheel of twenty-two spokes, corresponding to the twenty-two letters of the Hebrew alphabet. The order of the Hebrew alphabet is established in the alphabetically structured passages of the Old Testament, most notably Psalm 119 that praises God’s Word from Aleph to Tav, from beginning to end. This exemplifies how everything in the Bible Wheel is derived from Scripture and Scripture alone.”

This division of the Scriptures into portions of 7 can is portrayed in the Menorah.

http://www.biblewheel.com/Topics/Menorah.asp

528

“For those of you who study the DNA , which is really Jacob’s Ladder, research scientists are now using sound to heal damaged chromosomes.

The frequency used is  528 . WHICH  IS THE CENTRAL FREQUENCY OF THIS LIST OF NINE FREQUENCIES.”  {John Saba}

The Number 528 – the Key – Richard McGough
http://www.biblewheel.com/gr/gr_528.asp

This Key is literally the Key to the Bible. It appears here in the 22nd verse of the 22nd chapter of the all-inclusive Book of Isaiah, and is itself a multiple of the Number 22! In fact, it is the product of the number of letters in the Hebrew (22) and Greek (24) alphabets:

The KEY is subsumed in the same numerical category as the Alphabet itself:

Note also that the Key opens the 66 Books of the Galgal (Wheel = 66) and so is itself a multiple of 66:

Interestingly, The full value of the Name of Messiah is also 528

The Full Value of a word is calculated by replacing each letter of the word with its name, and summing the result.

The number 528 & the Key are linked to the resurrection as well which is an important facet of this topic of DNA.

Murdock Aramaic Translation
Rom 1:4  and was made known as the Son of God, by power, and by the Holy Spirit,) who arose from the dead, Jesus Messiah, our Lord,

ואתידע  ‘vayteedah’ corresponds to the Hebrew ידע ‘yada’ – to make known.  The literally meaning of ידע, is when man and woman come together and become one.  When the seed is planted in the womb.  This leads to a child being born, bursting forth from the womb.  Resurrection from the dead is the same concept.  The seed of the Word is planted in our hearts, this is the literally meaning of ‘born again’.  It literally means to be conceived from above.  We die, just as the seed must die in the earth.  We are then resurrected by the power of the Holy Spirit as new creatures, just as the plant springs forth from the earth.

It was declared that He is the Son by the resurrection

Rom 1:4  who was marked out the Son of God in power, according to the Spirit of holiness, by the resurrection of the dead, Jesus Christ our Lord;
There are two choices.  The Tree of Life or the Tree of knowledge.  The true light, or the false light.  We can put our faith in the Messiah which means our flesh has to die.  When we are resurrected is when we will be in His image, by His power and righteousness.  The tree of knowledge is trying to attain that eternal status by our works.  The Hindus and Buddhists have the concept of reincarnation.  The Kabbalists have the concept of climbing the Sephirotic ladder to reassemble Adam Kadmon.  The mystery religions have initiations to attain this level.  All of these concepts have degrees and graduations, which is one of the meanings of the Grail.  So man can choose.  Grace or works.  Faith in Messiah alone, or works of righteousness.

The Greek word for resurrection is ἀνάστασις anastasis’ which is used 44 times in Scripture.  This number further displays the true resurrection versus the false.  The true mark versus the mark of the beast.

The number 44 is linked to birth.  The word to give birth/child in Hebrew is ילד ‘yeled’ whose numerical value is 44.  Father + Mother {אב + אם} also has the value of 44.

The phrase ‘He is redeemed’ יגאל ‘yigal’ (Leviticus 25:30) is equivalent to 44, as well as ‘in the Jubilee’ ביבל ‘bayovel’ (Leviticus 25:28).

The Hebrew letter which is equivalent to 4 is ד  ‘dalet’ so 44 would be displayed דד.  This is the Hebrew word for bosom or love.  The bosom is linked to the love of the Father in giving His only begotten Son for the salvation of mankind.  It is interesting to note that the Hebrew word for lamb טלה ‘taleh’ also has the numerical value of 44.

דד (dalet dalet).  In Paleo Hebrew this would be rendered:

Combined these form the hexagram

44 ft = 528 inches = 26 cubits

26 = יהוה ‘Yahweh’

The number 8 is associated with the resurrection and rebirth.  8 x 66 (the number of books in the Bible) gives the number 528

He resurrects us in/from His Word

Psa 119:25  DALETH: My soul clings to the dust; give me life according to Your Word.
Psa 119:37  Turn my eyes from seeing vanity; in Your way give me life.
Psa 119:40  Behold, I have longed for Your Precepts; grant to me life in Your righteousness.
Psa 119:50  This is my comfort in my affliction; for Your Word has given me life.
Psa 119:93  I will never forget Your Precepts; for with them You gave me life.
Psa 119:107  I am greatly afflicted; O Jehovah, give me life according to Your Word.
Psa 119:149  Hear my voice by Your mercy, O Jehovah; give me life by Your judgment.
Psa 119:156  O Jehovah, Your tender mercies are great; give me life according to Your judgments.
Psa 119:159  See how I love Your Precepts, O Jehovah; give me life according to Your mercy.
Rom 8:2  For the Law of the Spirit of life in Christ Jesus set me free from the law of sin and of death.

Php 3:20  For our citizenship is in Heaven, from where we also wait for a Savior, the Lord Jesus Christ,
Php 3:21  who will transform our body of humiliation, for it to be conformed to His body of glory, according to the working of Him to be able even to subject all things under Himself.
2Co 4:14  knowing that He who raised up the Lord Jesus will also raise us up through Jesus, and will present us with you.
It is interesting to note that there are 66 bones in the human arm and shoulders corresponding to the 66 books of the Bible.

The Messiah, the Word, is likened to the Arm of God (Isaiah 53:1).  The bones of the human arm and hand are a picture of the Word. The Messiah is specifically described as the ‘Hand’ of God (Psalm 118:14-16; Isaiah 48:13; Acts 5:31 etc.). The human hand consists of 27 bones which correspond to the 27 books of the New Testament. These bones are divided into 3 parts. 5 metacarpal bones of the palm corresponding to the Gospels & Revelation. 14 bones of the fingers corresponding to the epistles of Paul and 8 bones in the wrist corresponding to the epistles of the other Apostles…

The hand is connected to the three bones of the Arm (Isaiah 40:10; 63:5-8; Psalm 44:3; Deuteronomy 33:2 etc.) which correspond to the Torah, Prophets & Writings. The arm connects to the shoulder of which we are yoked to the Most High (Matthew 11:30), walking in one consent (Zephaniah 3:9).

In short, the 27 bones of the hand connect to 3 bones in the arm which equals 30.  30 bones in each arm and hand add up to 60.  This is amazing as the arms connect to the shoulders which consist of the 2 shoulder bones themselves that are connected to 2 clavicles and 2 scapulas which = 6.  60+6= 66…the exact number of books in the Bible!

The Hebrew word for shoulder is שכם ‘shekhem’ which is also linked to the resurrection as the word literally means to rise early and place a load on the shoulders in order to depart.

Gen 22:3  And Abraham started up early {שכם ‘shekhem’} in the morning and saddled his ass, and he took two of his youths with him, and his son Isaac. And he split wood for a burnt offering, and rose up and went to the place which God had said to him.Genesis 22 is the portion of Scripture where Abraham is called to sacrifice his son Isaac in a foreshadowing of the crucifixion of Messiah.  It was on this mount that the LORD would be seen.

Image

דמה  ‘damah’ which means image, comes from the root דם ‘dam.’ The word for blood is דם ‘dam’ which combines the letter mem which means water and dalet which means a door.

The waters from the door is depicted in the Word as the Living Waters that come forth from the Throne of God. Messiah Jesus is the Living Waters (John 4:10-14; 7:37-39)

Fountain of Life

Rev 21:6  And he said unto me, It is done. I am Alpha and Omega, the beginning and the end. I will give unto him that is athirst of the fountain of the water of life freely.
Rev 22:1  And he shewed me a pure river of water of life, clear as crystal, proceeding out of the throne of God and of the Lamb.
Rev 22:2  In the midst of the street of it, and on either side of the river, was there the tree of life, which bare twelve manner of fruits, and yielded her fruit every month: and the leaves of the tree were for the healing of the nations.
Rev 22:14  Blessed are they that do his commandments, that they may have right to the tree of life, and may enter in through the gates into the city.
Isa 55:1  Ho, every one that thirsteth, come ye to the waters, and he that hath no money; come ye, buy, and eat; yea, come, buy wine and milk without money and without price.
Isa 55:2  Wherefore do ye spend money for that which is not bread? and your labour for that which satisfieth not? hearken diligently unto me, and eat ye that which is good, and let your soul delight itself in fatness.

Psa 36:7  How excellent is thy lovingkindness, O God! therefore the children of men put their trust under the shadow of thy wings {This points back to Genesis 1:2-5 and the Spirit hovering over the waters.}

Psa 36:8  They shall be abundantly satisfied with the fatness of thy house; and thou shalt make them drink of the river of thy pleasures {H5730 עדן‛eden}
Psa 36:9  For with thee is the fountain of life: in thy light shall we see light.
Notice the connection between the coming Kingdom of Messiah and the beginning.  The Spirit hovering over the waters, the living waters from His throne, Light springing forth…

Who abides in His shadow? Zion
Psa 36:7  How precious is Your mercy, O God! And the sons of men take refuge in the shadow of Your wings.
Isa 51:16  And I have put My Words in your mouth, and covered you in the shade of My hand, to plant the heavens and found the earth, and to say to Zion, You are My people.
Isa 51:3  For Jehovah comforts Zion. He comforts all her desolations, and He makes her wilderness like Eden, and her desert like the garden of Jehovah; joy and gladness shall be found in it, thanksgiving and the voice of singing praise.
Eze 47:1  And He made me turn back to the opening of the house. And, behold, water came out from under the threshold of the house eastward. For the face of the house is east, and the water came down from under the right side of the house, at the south from the altar.

Psa 36:9  For with You is the fountain of life; in Your light we see light.

H4726
מקר  /  מקור
mâqôr
BDB Definition:
1) spring, fountain

Notice the connection between the word for fountain and giving birth.  Out of the side of Messiah came forth water and blood to give birth to His Bride.

Strongs concordance
H4726
מקר    מקור
mâqôr  mâqôr
maw-kore’, maw-kore’
From H6979; properly something dug, that is, a (generally) source (of water, even when naturally flowing; also of tears, blood (by euphemism of the female pudenda); figuratively of happiness, wisdom, progeny): – fountain, issue, spring, well (-spring).

Brown Driver Briggs
H4726
מקר  /  מקור
mâqôr
BDB Definition:
1) spring, fountain
1a) spring
1a1) of source of life, joy, purification (figuratively)
1b) of the eye (figuratively)
1c) source (of menstruous blood)
1d) flow (of blood after child birth)
Lev 12:7  And he shall bring it near before Jehovah, and shall atone for her; and she shall be cleansed from the fountain of her blood; this is the law of her who bears, whether a male or a female.
1Jn 5:5  Who is the one overcoming the world except the one who believes that Jesus is the Son of God?
1Jn 5:6  This is the One coming through water and blood, Jesus Christ; not by the water only, but by the water and the blood. And the Spirit is the One witnessing, because the Spirit is the truth.
1Jn 5:7  For there are three bearing witness in Heaven: the Father, the Word, and the Holy Spirit; and these three are one.
1Jn 5:8  And there are three who bear witness on the earth: The Spirit, and the water, and the blood; and the three are to the one.

The Spirit, the water, and the blood are one.  The Spirit is likened to the living waters (John 7:37-39), the living waters come forth from His throne (Revelation 21:6; 22:1-2, 14)  How does the blood connect to this?  Our bodies are a picture of His Temple.  His throne = the human heart from whence flows the river of life (blood)…

The eternal organs in our bodies are a shadow picture of the Kingdom.  Our bodies are His Temple (Ephesians 2:21-22; 5:30; 1 Corinthians 6:19).   In the book of Revelation (Chapter 4) John is shown a vision of the Throne of God.  Around the throne and the 4 living creatures are 24 elders (Revelation 4:4) representing the 24 ribs surrounding the human heart.  From the heart blood is pumped to the Lungs.  As seen in Genesis 1:2-5 , the etymology of the English word ‘Lung’ traces back to the meaning of Light.  In our bodies our lungs have 7 vascular bundles called nodes.  These represent the 7 Spirits of God (Revelation 4:5; Isaiah 11:1-3).  These 7 Spirits/Ruach/Breathe are pictured in the earthly Tabernacle/Temple by the Menorah.  The Menorah is a picture of the Tree of Life.  The Light of the world.

Rev 4:5  And out of the throne come forth lightnings and thunders and voices. And seven lamps of fire are burning before the throne, which are the seven Spirits of God;
The lightning corresponds to the electrical activity of the heart.  The thunderings are the ‘Lub Dub‘ of the heart.

The mark is synonymous with an Image.  The word for mark is את (aleph tav) which is significant because it is a title of Messiah (Revelation 1:8, 11; 21:6; 22:13) as well as represents the Hebrew alphabet of which DNA is modeled after.

את & תא

This is the root for the word sign/mark.  This is significant because the Word of God is a sign on the hand and the forehead (Deuteronomy 6:8).  The mark of God is His Word.  The mark of the beast is lawlessness for the beast is the man of sin (2 Thessalonians 2:3; Psalm 130:3; Jeremiah 2:22; Job 10:14) .

The Hebrew word for ‘letter’ is אות which is from the same root of  aleph tav.

In Greek this word is:

G4592
σημεῖον
sēmeion

This is where semiology comes from, which is the study of signs/symbols.  A related word is semen which means seed.  This is very interesting because DNA is a ‘language’ consisting of letters, sentences which is passed through the seed.

Tav aleph is related to the word tav תו  and aleph tav את and means a mark/boundary.

תא  tav aleph relates to the word tar תר which means the ‘mark of man’ or the border/outline.

From this root we get ta’ar and to’ar.  These words mean form, outline or border.  This is an important connection to see in that the mark of the beast versus the mark of God ultimately reflects whose image/form you are in.

This connection between the mark and the image/form/outline/shadow picture of the LORD Jesus versus the antichrist is further seen in that the word Torah comes from this same root.

Believers are/will be the sons of God through the redemption of our bodies.

Joh 1:12  But as many as received him, to them gave he power to become the sons of God, even to them that believe on his name:
Joh 1:13  Which were born, not of blood, nor of the will of the flesh, nor of the will of man, but of God.
Tit 3:5  Not by works of righteousness which we have done, but according to his mercy he saved us, by the washing of regeneration, and renewing of the Holy Ghost;
Tit 3:5 He saved us, not by works of righteousness which we have done but according to His compassion, through the washing of rebirth, and renewal by the Set-apart Spirit,
1Pe 1:23  Being born again, not of corruptible seed, but of incorruptible, by the word of God, which liveth and abideth for ever.
1Jo 3:9  Whosoever is born of God doth not commit sin; for his seed remaineth in him: and he cannot sin, because he is born of God.
Jam 1:18  Of his own will begat he us with the word of truth, that we should be a kind of firstfruits of his creatures.
Jas 1:21  On account of this, putting away all filthiness and overflowing of evil, in meekness receive the implanted Word being able to save your souls.
In the resurrection we shall be given glorified bodies like the Messiah.  The Last Adam of 1 Corinthians 15:45
1Jo 3:1  Behold, what manner of love the Father hath bestowed upon us, that we should be called the sons of God: therefore the world knoweth us not, because it knew him not.
1Jo 3:2  Beloved, now are we the sons of God, and it doth not yet appear what we shall be: but we know that, when he shall appear, we shall be like him; for we shall see him as he is.
Mat 22:30  For in the resurrection they neither marry nor are given in marriage, but they are as the angels of God in Heaven.
Sons of God through the redemption of the body
Rom 1:1  Paul, a slave of Jesus Christ, a called apostle, separated to the gospel of God,
Rom 1:2  which He promised before through His prophets in the holy Scriptures,
Rom 1:3  concerning His Son who came of the seed of David according to flesh,
Rom 1:4  who was marked out the Son of God in power, according to the Spirit of holiness, by the resurrection of the dead, Jesus Christ our Lord;
Rom 8:16  The Spirit Himself witnesses with our spirit that we are children of God.
Rom 8:17  And if children, also heirs; truly heirs of God, and joint-heirs of Christ, if indeed we suffer together, that we may also be glorified together.
Rom 8:18  For I calculate that the sufferings of the present time are not worthy to compare to the coming glory to be revealed in us.
Rom 8:19  For the earnest expectation of the creation eagerly awaits the revelation of the sons of God.
Rom 8:20  For the creation was not willingly subjected to vanity, but through Him subjecting it, on hope;
Rom 8:21  that also the creation will be freed from the slavery of corruption to the freedom of the glory of the children of God.
Rom 8:22  For we know that all the creation groans together and travails together until now.
Rom 8:23  And not only so, but also we ourselves having the firstfruit of the Spirit, also we ourselves groan within ourselves, eagerly expecting adoption, the redemption of our body;

The entrance to the Kingdom and the true path is summed up by Paul in Philippians 3.

Php 3:8  But, no, rather I also count all things to be loss because of the excellency of the knowledge of Christ Jesus my Lord, for whose sake I have suffered the loss of all things and count them to be trash, that I might gain Christ
Php 3:9  and be found in Him; not having my own righteousness of Law, but through the faith of Christ, having the righteousness of God on faith,
Php 3:10  to know Him and the power of His resurrection, and the fellowship of His sufferings, having been conformed to His death,
Php 3:11  if somehow I may attain to a resurrection out of the dead.
Php 3:12  Not that I already received or already have been perfected, but I press on, if I also may lay hold, inasmuch as I also was laid hold of by Christ Jesus.
Php 3:13  Brothers, I do not count myself to have laid hold, but one thing I do, forgetting the things behind, and stretching forward to those things before,
Php 3:14  I press on after a mark for the prize of the high calling of God in Christ Jesus.
Php 3:15  Then as many as are perfect, let us be of this mind; and if you think anything differently, God will also reveal this to you.
Php 3:16  Yet as to where we have arrived, walk by the same rule, being of the same mind.
Php 3:17  Be fellow-imitators of me, brothers, and consider those walking this way, even as you have us for a pattern.
Php 3:18  For many walk as hostile to the cross of Christ, of whom I often told you, and now even weeping I say it,
Php 3:19  whose end is destruction, whose god is the belly, and who glory in their shame, the ones thinking earthly things.
Php 3:20  For our citizenship is in Heaven, from where we also wait for a Savior, the Lord Jesus Christ,
Php 3:21  who will transform our body of humiliation, for it to be conformed to His body of glory, according to the working of Him to be able even to subject all things under Himself.
Act 14:22  Confirming the souls of the disciples, and exhorting them to continue in the faith, and that we must through much tribulation enter into the kingdom of God.

The path to the kingdom and eternal life is through Messiah where man must die to himself that Messiah might be formed through us.

Gal 2:20  I have been crucified with Christ, and I live; yet no longer I, but Christ lives in me. And the life I now live in the flesh, I live by faith toward the Son of God, the One loving me and giving Himself over on my behalf.
Gal 2:21  I do not set aside the grace of God; for if righteousness is through Law, then Christ died without cause.

This is a deep concept as the ‘law’ spoken of by Paul in Galatians 2:21 is seen in our bodies in the DNA molecule as this study has explained in detail.  Righteousness only comes through faith in Messiah and the nailing of that law to the tree.  Eternal life can only be gained through the ‘death’ of our current DNA.

Col 2:9  For in Him dwells all the fullness of the Godhead bodily;
Col 2:10  and having been filled, you are in Him, who is the Head of all rule and authority,
Col 2:11  in whom also you were circumcised with a circumcision not made by hands, in the putting off of the body of the sins of the flesh, by the circumcision of Christ,
Col 2:12  being buried with Him in baptism, in whom also you were raised through the faith of the working of God, raising Him from among the dead.
Col 2:13  And you, being dead in the deviations and the uncircumcision of your flesh, He made alive together with Him, having forgiven you all the deviations,
Col 2:14  blotting out the handwriting in the ordinances against us, which was contrary to us, even He has taken it out of the midst, nailing it to the cross;
Col 2:15  having stripped the rulers and the authorities, He made a show of them in public, triumphing over them in it.
Messiah triumphed over His enemies, the last of which was death (1 Corinthians 15:54-56) which came forth from sin brought forth by the serpent in the tree of knowledge (Hebrews 2:14; 1 Corinthians 15:21, 26).  It is no surprise then that Messiah was crucifed on a cross in the shape of the chromosome, portraying Himself as a serpent on a tree (John 3:14) which is a figure of DNA.

The counterfeit path is ‘as above, so below.’  Man becoming god, knowing good and evil and choosing his own way.  ‘Do what thou wilt shall be the whole of the law.’  The true path is to die to the flesh that we might live to the Spirit (Romans 8:13).  The false path is preservation of the flesh, the ultimate fulfillment of which is manipulation of DNA in on attempt to overcome death.  On a deeper level, this preservation of the flesh is another form of ‘works of the law.’

Gal 2:16  Knowing that a man is not justified by the works of the law, but by the faith of Jesus Christ, even we have believed in Jesus Christ, that we might be justified by the faith of Christ, and not by the works of the law: for by the works of the law shall no flesh be justified.
We are saved by grace through faith.  In Ephesians 2, Paul sums up this study.  Man is dead due to sin.  Corruption entered the DNA of man when the fruit of the tree of knowledge was consumed.  Man must now die.  Through faith in Messiah however, man can yet live.  Man can be born again with a new body in the Image of Him who saved him.

Eph 2:1  and you being dead in deviations and sins,
Eph 2:2  in which you formerly walked according to the course of this world, according to the ruler of the authority of the air, the spirit now working in the sons of disobedience,
Eph 2:3  among whom we also all conducted ourselves in times past in the lusts of our flesh, doing the things willed of the flesh and of the understanding, and were by nature the children of wrath, even as the rest.
Eph 2:4  But God, being rich in mercy, because of His great love with which He loved us,
Eph 2:5  even we being dead in deviations, He made us alive together with Christ (by grace you are being saved),
Eph 2:6  and raised us up together and seated us together in the heavenlies in Christ Jesus,
Eph 2:7  that He might demonstrate in the ages coming on, the exceeding great riches of His grace in kindness toward us in Christ Jesus.
Eph 2:8  For by grace you are saved, through faith, and this not of yourselves; it is the gift of God;
Eph 2:9  not of works, that not anyone should boast;
Eph 2:10  for we are His workmanship, created in Christ Jesus unto good works, which God before prepared that we should walk in them.
Eph 2:11  Because of this, remember that you, the nations, were then in the flesh (those having been called Uncircumcision by those having been called Circumcision in the flesh made by hands)
Eph 2:12  that at that time you were without Christ, alienated from the commonwealth of Israel and strangers of the covenants of promise, having no hope and without God in the world.
Eph 2:13  But now, in Christ Jesus you who then were afar off, came to be near by the blood of Christ.
Eph 2:14  For He is our peace, He making us both one, and breaking down the middle wall of partition,
Eph 2:15  in His flesh causing to cease the enmity, the Law of the commandments in decrees, that He might in Himself create the two into one new man, making peace,
Eph 2:16  and might reconcile both in one body to God through the cross, slaying the enmity in Himself.
Eph 2:17  And coming, He proclaimed “peace to you, the ones afar off, and to the ones near.” Isa. 57:19
Eph 2:18  For through Him we both have access by one Spirit to the Father.
Eph 2:19  So, then, you are no longer strangers and tenants, but you are fellow citizens of the saints and of the family of God,
Eph 2:20  being built up on the foundation of the apostles and prophets, Jesus Christ Himself being the cornerstone,
Eph 2:21  in whom all the building being fitted together grows into a holy temple in the Lord,
Eph 2:22  in whom you also are being built together into a dwelling place of God in the Spirit.

In the Beginning was the Word

The equivalent of Genesis 1:1-5 is found in John 1:1

Joh 1:1  In the beginning was the Word, and the Word was with God, and the Word was God.
Joh 1:2  He was in the beginning with God.
Joh 1:3  All things came into being through Him, and without Him not even one thing came into being that has come into being.
Joh 1:4  In Him was life, and the life was the light of men;
Joh 1:5  and the light shines in the darkness, and the darkness did not overtake it.
Joh 1:6  There was a man sent from God; his name was John.
Joh 1:7  He came for a witness, that he might witness concerning the Light, that all might believe through Him.
Joh 1:8  He was not that Light, but that he might witness concerning the Light.
Joh 1:9  He was the true Light; He enlightens every man coming into the world.
Joh 1:10  He was in the world, and the world came into being through Him, yet the world did not know Him.
Joh 1:11  He came to His own, and His own did not receive Him.
Joh 1:12  But as many as received Him, to them He gave authority to become children of God, to the ones believing into His name,
Joh 1:13  who were born not of blood, nor of the will of the flesh, nor of the will of man, but were born of God.
Joh 1:14  And the Word became flesh and tabernacled among us. And we beheld His glory, glory as of an only begotten from the Father, full of grace and of truth.
Joh 1:15  John witnesses concerning Him, and has cried out, saying, This One was He of whom I said, He coming after me has been before me, for He was preceding me.
Joh 1:16  And out of His fullness we all received, and grace on top of grace.
Joh 1:17  For the Law was given through Moses, but grace and truth came through Jesus Christ.
Joh 1:18  No one has seen God at any time; the only begotten Son, who is in the bosom of the Father, that One declares* Him.

*manifests the image of the Most High

G1834
ἐξηγέομαι
exēgeomai
Thayer Definition:
1) to lead out, be leader, go before
2) metaphorically, to draw out in narrative, unfold a teaching
2a) to recount, rehearse
2b) to unfold, declare
2b1) the things relating to God
2b2) used in Greek writing of the interpretation of things sacred and divine, oracles, dreams, etc.
Part of Speech: verb
A Related Word by Thayer’s/Strong’s Number: from G1537 and G2233

This Greek word was used to translate the following Hebrew words in the Septuagint
G1834
ex egeomai     H3034    yadah (to make known)
ex egeomai     H3384    yarah hi. (to teach…root of the word torah)
ex egeomai     H5608    saphar pi. (record/scroll)

Here it can be seen that Messiah, who comes from the bosom of the Father, declares Him.  He makes Him known.  He makes known His teaching, His Word, when the Scroll of the Bible became flesh and walked among men.  This is why Christ declared to Thomas that when you are looking at Him you are seeing the Father.

Joh 14:6  Jesus said to him, I am the Way, and the Truth, and the Life. No one comes to the Father except through Me.
Joh 14:7  If you had known Me, you would have known My Father also; and from now on you do know Him, and have seen Him.
Joh 14:8  And Philip said to Him, Lord, show us the Father, and it is enough for us.
Joh 14:9  Jesus said to him, Am I so long a time with you, and you have not known Me, Philip? The one seeing Me has seen the Father! And how do you say, Show us the Father?
Joh 14:10  Do you not believe that I am in the Father and the Father is in Me? The Words which I speak to you I do not speak from Myself, but the Father who abides in Me, He does the works.
Joh 14:11  Believe Me that I am in the Father, and the Father is in Me; but if not, believe Me because of the works themselves.

His Body
Joh 14:18  I will not leave you orphans; I am coming to you.
Joh 14:19  Yet a little while and the world no longer sees Me, but you see Me. Because I live, you also shall live.
Joh 14:20  In that day you shall know that I am in My Father, and you are in Me, and I am in you.
Joh 14:21  He that has My commandments and keeps them, it is that one who loves Me; and the one that loves Me shall be loved by My Father, and I shall love him and will reveal Myself to him.

Verse 20 refers back to John 14:11 where Messiah tells Thomas that when we see Him we are seeing the image of the Father.  The Body of Christ is to be one with Him, He in us and we in Him in order to reveal His Image to the world.  Ultimately this will be fully seen at the resurrection when Messiah returns and we are resurrected into the fullness of His Image (1John 3:2).

In Hebrews 3:14, it states that we have become partakers of Messiah.  Just as Messiah said above, we in Him and He in us.  This word in Greek is ‘metochos’ which is translated from the following Hebrew words in the Septuagint.

Bachar – which means chosen, elect
Damim – which means blood(s)
Chaver – united, associated, to bind together (as in the Tabernacle).

Here we see that the Body of Messiah are the chosen people, in His image (blood/DNA) are His Tabernacle.

In 2 Peter 1:3 the Scriptures speak of believers becoming partakers of His divine nature.  This word nature in Greek is ‘phusis.’  It means to grow (as in germination) or natural production (as in lineal descent from a parent) it means a genus or a sort.  The Sons of God/the Manchild who will rule and reign with Messiah are to be in His image, in His nature.

1Jo 3:1  Behold, what manner of love the Father hath bestowed upon us, that we should be called the sons of God: therefore the world knoweth us not, because it knew him not.
1Jo 3:2  Beloved, now are we the sons of God, and it doth not yet appear what we shall be: but we know that, when he shall appear, we shall be like him; for we shall see him as he is.

Rom 8:14  For as many as are led by the Spirit of God, these are sons of God.
Rom 8:15  For you did not receive a spirit of slavery again to fear, but you received a Spirit of adoption by which we cry, Abba! Father!
Rom 8:16  The Spirit Himself witnesses with our spirit that we are children of God.
Rom 8:17  And if children, also heirs; truly heirs of God, and joint-heirs of Christ, if indeed we suffer together, that we may also be glorified together.
Rom 8:18  For I calculate that the sufferings of the present time are not worthy to compare to the coming glory to be revealed in us.
Rom 8:19  For the earnest expectation of the creation eagerly awaits the revelation of the sons of God.
Rom 8:20  For the creation was not willingly subjected to vanity, but through Him subjecting it, on hope;
Rom 8:21  that also the creation will be freed from the slavery of corruption to the freedom of the glory of the children of God.
Rom 8:22  For we know that all the creation groans together and travails together until now.
Rom 8:23  And not only so, but also we ourselves having the firstfruit of the Spirit, also we ourselves groan within ourselves, eagerly expecting adoption, the redemption of our body;

Gal 3:26  For ye are all the children of God by faith in Christ Jesus.
Gal 3:27  For as many of you as have been baptized into Christ have put on Christ.
Gal 3:28  There is neither Jew nor Greek, there is neither bond nor free, there is neither male nor female: for ye are all one in Christ Jesus.
Gal 3:29  And if ye be Christ’s, then are ye Abraham’s seed, and heirs according to the promise.

Gal 4:4  But when the fulness of the time was come, God sent forth his Son, made of a woman, made under the law,
Gal 4:5  To redeem them that were under the law, that we might receive the adoption of sons.
Gal 4:6  And because ye are sons, God hath sent forth the Spirit of his Son into your hearts, crying, Abba, Father.
Gal 4:7  Wherefore thou art no more a servant, but a son; and if a son, then an heir of God through Christ.

Eph 1:5  predestinating us to adoption through Jesus Christ to Himself, according to the good pleasure of His will,

Isa 8:18  Behold, I and the children whom Jehovah has given to me are for signs and wonders in Israel from Jehovah of Hosts, who dwells in Mount Zion.

Rev 21:6  And he said unto me, It is done. I am Alpha and Omega, the beginning and the end. I will give unto him that is athirst of the fountain of the water of life freely.
Rev 21:7  He that overcometh shall inherit all things; and I will be his God, and he shall be my son.

Leave a comment

This site uses Akismet to reduce spam. Learn how your comment data is processed.