The mark of the beast is a counterfeit of the mark of YHWH which is His Image, His Word. DNA, in specific human DNA, is a physical representation of the Word. The DNA in the body of man is the ‘word’/blueprint which is used to produce man who was created in the image of God. A corruption of the human DNA genome would constitute a corruption of the Image of YHWH and His Word. Messiah Jesus came to earth as the Word made flesh. The antichrist beast manifests as a corruption of the Word, a counterfeit Image of YHWH.
Image
Going back to part 1click here, it is seen that the mark is synonymous with an Image. The word for mark is את (aleph tav) which is significant because it is a title of Messiah (Revelation 1:8, 11; 21:6; 22:13) as well as represents the Hebrew alphabet of which DNA is modeled after.
את & תא
This is the root for the word sign/mark. This is significant because the Torah is a sign on the hand and the forehead (Deuteronomy 6:8). The mark of YHWH is His Word. The mark of the beast is lawlessness for the beast is the man of sin (2 Thessalonians 2:3; Psalm 130:3; Jeremiah 2:22; Job 10:14) .

The Hebrew word for ‘letter’ is אות which is from the same root of aleph tav.
In Greek this word is:
G4592
σημεῖον
sēmeion
This is where semiology comes from, which is the study of signs/symbolsclick here. A related word is semen which means seed. This is very interesting because DNA is a ‘language’ consisting of letters, sentences which is passed through the seed.
Tav aleph is related to the word tav תו and aleph tav את and means a mark/boundary.
תא tav aleph relates to the word tar תר which means the ‘mark of man’ or the border/outline.
From this root we get ta’ar and to’ar. These words mean form, outline or border. This is an important connection to see in that the mark of the beast versus the mark of YHWH ultimately reflects whose image/form you are in.
This connection between the mark and the image/form/outline/shadow picture of YHWH versus the antichrist is further seen in that the word Torah comes from this same root.

We can have the mark of YHWH and be in His image by walking in His Torah and letting Messiah live through us (Galatians 2:20), or we can have the mark of the beast and be in the image of satan by walking in his torah which is lawlessness (Ephesians 2:2-3Isaiah 30:8-11; 1 Peter 2:8). In reality, this ‘torah’ is the concept of ‘do what thou wilt shall be the whole of the law.’ The ability of man to decide what is good or evil, right or wrong instead of relying on the Word to define the two.
The word for image in Hebrew is ‘tsel’ which means a shadow cast by an object forming an image. This is also seen in the concept of being under the shadow of His wings, which for the current study represents dwelling under the branches of the Tree of Life. The counterfeit, of course, is the tree of knowledge and the shadow/image it casts. The word ‘tsel’ is the combination of the letter ‘tsadi’ which is the picture of a hunter, a man lying on his side with a spear or bow or a man with a fishing pole. The lamed is a the picture of a staff held by a shepherd which represents authority. Herein lies a beautiful picture of the current study. The shepherd who hunts. The Messiah, the Good Shepherd, holds out a ‘fishing pole’ whose bait is the fruit of the tree of Life. The idol/worthless shepherd lies in wait as a lion seeking whom he may devour.
The word translated as mark in Revelation is used only one other time in Scripture referring to man engraving an image to represent the Almighty
Act 17:29 Then being offspring of God, we ought not to suppose that the Godhead is like gold or silver or stone, engraved by art and the imagination of man.
This is the essence of the mark of the beast…it is a counterfeit worship of YHWH. This is what the golden calf was. Making a golden calf and calling it YHWH. This is who the antichrist will be. A counterfeit Jesus. Who was Messiah? He was the Word made flesh (John 1:14).
The Greek word that is translated as mark
G5480
χάραγμα
charagma
Thayer Definition:
1) a stamp, an imprinted mark
1a) of the mark stamped on the forehead or the right hand as the badge of the followers of the Antichrist
1b) the mark branded upon horses
2) thing carved, sculpture, graven work
2a) of idolatrous images
Part of Speech: noun neuter
A Related Word by Thayer’s/Strong’s Number: from the same as G5482
Another Greek word that comes from the same root is:
G5481
χαρακτήρ
charaktēr
Thayer Definition:
1) the instrument used for engraving or carving
2) the mark stamped upon that instrument or wrought out on it
2a) a mark or figure burned in (Lev_13:28) or stamped on, an impression
2b) the exact expression (the image) of any person or thing, marked likeness, precise reproduction in every respect, i.e facsimile
Part of Speech: noun masculine
A Related Word by Thayer’s/Strong’s Number: from the same as G5482
This word charakter is only used once in the Scriptures. It is translated as express image. Again we see a connection to the mark and the image.
Heb 1:3 who being the shining splendor of His glory, and the express image of His essence, and upholding all things by the Word of His power, having made purification of our sins through Himself, He sat down on the right of the Majesty on high, Psa. 110:1
DNA & the Word
DNA is a physical picture of the Word, it is a language that functions exactly the same as Hebrew, the language that traces back to Eden. DNA is the language of the book that is used to form our bodies, just as the Hebrew language is the language of the Word who became flesh and dwelt among us.
The DNA molecule is the instruction manual for the forming of amino acids which make the structural elements of proteins that turn into the biochemical units that drive all biological processes.
The proteins formed from the amino acids which the DNA molecule makes are 22 in number corresponding to the 22 letters in the Hebrew Aleph-Bet. These 22 letters point to Messiah Jesus who is described as the Alpha & Omega/Aleph – Tavclick here. The word for sign above is אות which is the same word in Hebrew word a ‘letter’. The 22 letters of the Hebrew Aleph-Bet form the Image of the Messiah who is the Word made flesh. This is seen in the physical realm in our bodies where the DNA forms 22 amino acids which make the proteins for each individual part of our bodies.
Isa 8:18 Behold, I and the children {Messiah and His body} whom YHWH has given to me are for signs (אתות – ‘letters’) and wonders in Israel from YHWH of Hosts, who dwells in Mount Zion.
Etymology of DNA
DNA is an abbreviation for deoxyribonucleic acid. When breaking down the different parts of this word it is seen that etymologically DNA points to the Word. This is no surprise as functionally, DNA is a picture of the Word.
The first part of the word is ‘de’ which means ‘from or according to.’ As in ‘de facto’ meaning in fact or reality in Latin.
This could translate into Hebrew as lamed or mem. In Aramaic the ‘d’ in front of a word is the same as ‘b’.
de – from, down from
The next part of deoxyribonucleic acid is the oxy. Oxy is a Greek word which means sharp or pungent. It is the origin of the word acrid. Oxy/Oxus in Greek traces back to the Hebrew word קוץ (qots) which means a thorn, or sharp. It is the origin of the Latin word ‘acacia’ which means a thorn and is used in reference to the wood used in the Tabernacle which is a major theme of this study as the Tabernacle was a shadow picture of Messiah, and consequently the Word.
deoxyribonucleic acid.
Ribose comes from the Hebrew word ‘chalav’ and is related to gum and the Hebrew word ‘gome.’ These all connect to the Word which will be discussed in more detail below. ‘Gome’ is the source for papyrus/paper and the Bible.
deoxyribonucleic acid.
The word nucleic means ‘something that comes from the nucleus.’ Nucleus comes from the Latin word ‘nucleus’ which means a ‘kernel, little nut.’ The word kernel comes from Germanic word ‘kurnilo’ which means the root of corn, ‘seed/grain.’ Kernel traces even farther back to the Hebrew word כרמל ‘karmel.’ ‘Karmel’ means a seed but a seed planted in a Garden in particular.
The word nucleus also links back to the Hebrew word קמט ‘qamat’ which has the meaning of compressing. ‘Qamat’ is the origin of the Old English ‘hem’ which was a doubling over or compressing of the hem. Interestingly, on the hem of the garments of Messiah were placed tsitsit where are intimately linked with DNAClick Here
The final part of deoxyribonucleic acid is the word acid. Acid comes from the Latin ‘acidus’ meaning sour or sharp. Tracing the word acid farther back links it with the Hebrew word ‘zayit’ which means the olive tree. The Olive tree is a picture of Messiah/the Word/the Tree of Life which will be discussed in more detail below.
de – according to
oxi – sharp (Hebrews 4:12 the Word is sharp, like unto a two edged sword)
ribo – sweet (Psalm 119:103) Papyrus/Word
nucleic – Seed (Luke 8:11)
Acid – Olive (Tree of Life – Romans 11).
Life click here
Life comes forth from the instructions in the DNA molecule. The Holy Scriptures proclaim that the Word = Life.
Joh 6:63 It is the spirit that quickeneth; the flesh profiteth nothing: the words that I speak unto you, they are spirit, and they are life.
See also Deuteronomy 32:47; 1John 1:1-2; Philippians 2:16; John 11:25; 14:6; 1John 5:20.
The English word life comes from the Hebrew word ‘chalav’ which means ‘fat, choicest part, milk.’ Interestingly, the word protein traces back to this same Hebrew word. Life comes forth from the proteins produced by the DNA molecule in the cell of living organisms…
Life and its connections to the current study are discussed in more detail in Messiah in the Torah: Genesis 1:20-23click here
523

The Hebrew word for Father, אב, also equals 523 in ‘full’ value. The Full Value of a word is calculated by replacing each letter of the word with its name, and summing the result.
Further connecting God to the Aleph-Bet is by calculating the entire sum of the Hebrew Alphabet which comes to 1495. This is equivalent to the Greek phrase ‘The Everlasting God.’
Going back to the number 523, it is interesting to note that the Greek word ἐγερσις ‘egersis,’ which means ‘resurrection’ (Matthew 27:53) also equals 523. As seen in part 1click here, the resurrection is intimately linked to the mark.
Protein & Hebrew
Interestingly the English word protein traces back to the Hebrew word ‘avar’ which is from whence the word ‘Hebrew’ עברית ‘ivrit’ comes from. Protein comes from the Greek word ‘protos’ which comes from ‘avar.’
E-Word Dictionary – Isaac Mozeson pg 312
Notice that the word עבר is related to the word בר ‘bar’ which means ‘son’ (Psalm 2:12). It is no surprise then that the prophet Isaiah (Isaiah 8:18) speaks of those who are in Messiah as signs/letters (אות) and children/’protein’. Notice that the 22 amino acids which correspond to the 22 letters of the Hebrew Aleph-Bet make proteins which correspond to the Hebrew language.
DNA & Language
Nucleotide Character (Letter)
Codon Letter
Gene Word
Operon Sentence
Regulon Paragraph
DNA Book
Simplified it could be said
Nucleotide bases Letters
Codons Words
Genes Sentences
Book DNA
The ‘letters’ of the DNA strand are comprised of Adenine, Guanine, Cytosine and Thymine (A,C,G,T). These four letters combine in pairs to make all the information needed to form life. Adenine always pairs with Thymine and Guanine with Cytosine. This points to the Hebrew language where all words come forth from a 2 letter parent root.
This is also alluded to in Scripture.
Isa 34:16 Search and read from the Book of YHWH; not one of these misses, each not lacking her mate; for He has commanded my mouth, and by His Spirit He has assembled them.
These 2 letter parent roots, for the most part, can’t be used in language without the adding of another letter to form the 3 letter root of which most are familiar with in the Hebrew language. This process happens through the means of messenger RNA. RNA is an exact copy of the DNA molecule where the helix ladder ‘unzips’ itself in order to make an exact copy.
DNA then is a picture of the Father on His throne. The Messenger RNA is a picture of Messiah who comes to earth to bring many sons to Glory. This DNA to RNA and back to DNA process is also seen in the work of the Scribes who made exact copies of the Torah.
DNA transcription
DNA, Design, and the Origin of Life
Charles B. Thaxton, Ph.D.
“…the genetic code can be best understood as an analogue to human language. It functions exactly like a code — indeed, it is a code: it is a molecular communication system within the cell…
In recent years, scientists have applied information theory to biology, and in particular to the genetic code… It provides a mathematical means of measuring information…
The conclusion drawn from the application of information theory to biology is there exists a structural identity between the DNA code and a written language…
Molecular biology has now uncovered an analogy between DNA and written human languages. It is more than an analogy, in fact: in terms of structure, the two are ‘mathematically identical.’…”
http://www.redicecreations.com/specialreports/2006/03mar/holygrail.html
“A team of Russian geneticists and linguists, researching the electromagnetic behavior of DNA, discovered that “junk” DNA is critical not only for the construction of our body but also in data storage and communication. The Russian team discovered that this 90% of our DNA follows the same rules of grammar, syntax and semantics as human languages. Their conclusion is that human language mirrors the structure of our DNA.”
Hebrew grammar
DNA works in the same way as the Hebrew language. Each Hebrew word traces back to a 2 letter ‘parent root.’ This parent root, for the most part, can’t be used in a sentence without the addition of a 3rd letter. Hebrew verbs require a 3 consonant root in order to be conjugated. This 3 letter root is called the ‘child root.’
The DNA helix is formed through the combination of 2 nucleotides. Adenine and Thymine or Cytosine and Guanine combinations. In order for amino acids of the genetic code to be formed into proteins the nucleotides must combine into 3 letter combinations to make ‘codons.’
When the DNA is in the nucleus, the DNA contains two letter pairs held together by hydrogen bonds. The letters are unable to form a body without leaving the nucleus and taking on a 3rd letter, just like the Hebrew language. In order to take on a 3rd letter the DNA helix must “unwind”, where it copies itself onto messenger RNA. The letters then make one long string of letters. Just like an ancient Torah scroll.
The DNA strand is made of letters:
ATGCTCGAATAAATGTGAATTTGA
The letters make words:
ATG CTC GAA TAA ATG TGA ATT TGA
The words make sentences:
<ATG CTC GAA TAA> <ATG TGA ATT TGA>
These “sentences” are called genes. Genes tell the cell to make other molecules called proteins. Proteins allow a cell to perform special functions, such as working with other groups of cells to make hearing possible.
The DNA letters are “transcribed” by Messenger RNA, just as Scribes transcribed one Torah scroll onto another scroll. The messenger RNA is also called the Servant RNA. The Messenger RNA can go outside the nucleus, whereas the DNA must stay inside the nucleus. The DNA does not leave the nucleus in order to preserve the original copy. If the mRNA obeys the rules He will overcome the mutations (sins) of the world when He enters the cytoplasm.
The mRNA leaves the nucleus through a hole called the gatekeeper, that prepares the way for the mRNA to leave the nucleus. When the mRNA leaves the nucleus it is translated.
The 3 letters represent amino acids. There are 22 amino acids that are read by the ribosomes to produce protein. These amino acids are divided up into codons, from the English word code which traces back to the Hebrew word ‘sod’.
Murray Eden of MIT one of the mathematicians attending the Wistar Institute Symposium (1966)
“DNA, like other languages, cannot be tinkered with by random variational changes; if that is done, the result will always be confusion…No currently existing formal language can tolerate random changes in the symbol sequences which express its sentences. Meaning is invariably destroyed.”
You can not add or take away from the DNA or a mutation results
Deu 12:32 All the things that I command you, take heed to do them and you shall not add to it, nor take away from it.
Mat 5:17 Do not think that I came to annul the Law or the Prophets; I did not come to annul, but to fulfill.
The genetic information that is read by the ribosomes determines what will be formed. Interestingly, tracing back the word ‘information’ brings forth the same concept. The English word ‘information’ comes from the Latin word ‘informare’ which means to shape, form, train, instruct, educate, etc. Informare breaks down from ‘in’ meaning into and ‘forma’ meaning a form. The English word form comes from the Old French word ‘forme’ which means a physical form, appearance, shape, image etc. This traces to the Latin word ‘forma’ which further traces to the Greek word ‘morphe’ meaning form, beauty, outward appearance.
This word ‘morphe’ is interesting as it is used in only a few places in the New Testament, all of which are referring to Messiah. (Mark 16:12; Philippians 2:6-7; Galatians 4:19). ‘Morphe’ comes from the root ‘meros’ which means the constituent parts of a whole. Combining small parts to make an image, this describes DNA becoming protein (image) very well. Morphe is used to translate multiple words, all of which link to the current study.
G3444
morphe H2122 ziv – an image that stands out
morphe H6754 tselem – shadow, image
morphe H8389 toar – mark or image, discussed in greater detail above.
morphe H8403 tavnit – image, pattern- the word used for pattern in reference to the Tabernacle/Temple of YHWH. The significance of this has been discussed throughout this series of studies in reference to Messiah and His body.
morphe H8544 temunah – Image, form- the root of this word is ‘מן’ which means ‘living waters/blood’ usually translated as type or kind which is linked to the passing of genes from father to son through ‘the blood.’
Epigenome
The significance and importance of the epigenome has only recently been discovered by scientists. The genetic material which makes our eyes, ears, nose, feet, liver, heart etc., are all the same. It is the epigenome that translates this information to make each part what it is. This corresponds to the Holy Spirit. The Scriptures can be read by anyone yet it is only through the Holy Spirit that one can understand and see the ‘image’ of God.
Interestingly, the epigenome doesn’t alter the DNA sequence, it ‘turns on’ or ‘turns off’ different parts of the sequence. A good example of this is cancer. Cancer may be caused by several different mutations or epigenetic changes that cause genes to be expressed (turned on) and/or silenced (turned off) when they should not be.
Cancer is an aberration in the cells which leads to death which can be caused by mutations (adding or taking away) or by certain parts of the ‘Word’ being ‘turned on or off.’ Not only does changing the Word lead to death, but misinterpretation of the Word.
Rom 7:24 O wretched man that I am! Who shall deliver me from the body of this death?
Rom 7:25 I thank God through Jesus Christ our Lord! So then I myself with the mind truly serve the Law of God, and with the flesh the law of sin.
The epigenome that ‘translates’ the genetic code is likened to the Spirit. The Holy Spirit teaches man and leads him to interpret the Word correctly where he can be formed into the Image of Messiah. (2 Corinthians 3:18; Galatians 4:19; Romans 8:29) whereas the spirit of evil works in the children of disobedience where the Word is corrupted and leads to them being formed into the corrupted man of sin (Ephesians 2:2-3; Isaiah 1:4; 57:4; 1 Peter 1:13-16).
Interestingly, DNA is dwelling in the midst of a matrix of water. The fact that it is in water plays a crucial role in how it gets its helix ladder shape. Because the four DNA bases are insoluble in water, they turn towards the interior molecule to form and join the two letter ‘roots.’ They then wrap themselves around each other to avoid contact with their wet environment. The epigenome is then likened to the Spirit hovering over the waters in the beginningclick here.
Gen 1:2 And the earth was without form, and void; and darkness was upon the face of the deep. And the Spirit of God moved upon the face of the water.
Gen 1:3 And God said, Let there be light; and there was light.
Psalm 139 speaks of man being formed in the womb and on a deeper level alludes to the DNA molecule.
Psa 139:15 My bones were not hidden from You when I was made in secret; when I was woven* in the depths of the earth. *רקם
râqam…this words means fashion, needlework or twisted threads (DNA).
Psa 139:16 Your eyes saw my embryo; and in Your book (an allusion to DNA the ‘book of life’) all my members were written the days they were formed, and not one was yet among them.
Here we seen that the womb is likened to the earth. In Hebraic thoughtclick here, the womb is also likened to waters. As will be seen below, DNA also produces ‘light.’ Here we see a replay in our very cells of the beginning of the universe.
Ribosomes
The ribosomes ‘read’ the 22 amino acids in order to form proteins. Ribosomes are a picture of Scribes.
The word ribosome comes from ribose which is a ‘sugar’ that is formed from ‘gum arabic.’ Tracing back this word gum brings forth some interesting connections to scribes. Gum arabic comes forth from the acacia tree mentioned above and is used in the process of making ink for ancient Torah scrolls. More on this below. In the Scriptures, gum comes forth from חלבנה ‘chalvanah.’ This is translated as ‘galbanum’ as in Exodus 30:34.
‘Chalvanah’ comes from the root ‘chalav’ which means the fat or choicest part. This was what was offered to YHWH on the altar along with the kidneys and liver (Exodus 29:13). Interestingly, the English word liver comes from the Hebrew word ‘chalav.’ This is also the origin of the English word ‘lip’ which is made up of fatty tissue.
The word ‘lobe’ as in the ear lobe comes from ‘chalav’ as well. It is not hard to see the connection between lips, hearing (earlobe) and scribes (Proverbs 8:6).
The English word ‘gum’ comes from the Hebrew גם ‘gam.’
The connection between ‘gam’ and scribes/the Word is seen in more detail in Messiah in the Torah: Genesis 1:9-13click here. Gam has the meaning of a collection of a group of animals at a watering hole, in particular camels as seen in Genesis 24. Gam (gimmel) is the number 3 in Hebrew which is linked to resurrection and maturity which is a major theme of the current study on the mark. Gamal is also the word for a camel which is used as a descriptive tool of satan in Kabbalistic writingsclick here. Here is seen the counterfeit of the ribosome or scribe. Corrupting the word/DNA to bring forth a counterfeit image/protein.
The Hebrew letter gimel originally was pronounced as gam.

This links back to baptism, as seen above, as the meaning of collecting at the waters.
To further illustrate this, the word ‘agam’, which comes from the root ‘gam’ is translated as pool in English, just as miqveh (baptism) is.

Amazingly, the account of Moshe being drawn out of the waters after being hidden for 3 months is linked to this word.
Exo 2:3 And she was not able to hide him any longer, and she took a basket for him made of papyrus (Hebrew ‘gome’ גמא), and she daubed it with bitumen and with pitch. And she put the child in it, and placed it in the reeds by the lip of the Nile.
The Hebrew letter gimmel/gam is a pictograph of a foot but also represents a camel.


The Holy Scriptures link the camel to the gathering of the waters:
Gen 24:11 And he made the camels kneel* outside the city, by a well of water at the time of the evening, the time that women go out to draw.
*In Hebrew this word is barakh which connects with the word gamal/miqveh through the English word ‘pool.’ The word pool is translated from 3 different Hebrew words. Agam, miqveh, and berakah.
This word comes from the root:
Notice that the parent root of this word is בר, bar. This is the word for Son (Psalm 2:12). It is also the root for the word for soap.
Washing of the body, as well as washing of the clothing points to Messiah. At Mt. Sinai, Israel was to was their clothing and be ready for the 3rd day when they would meet YHWH. Interestingly, the human body was designed to bathe with soap every 2-3 days.
The word above, ‘bar’, is translated as son in Psalm 2:12; Proverbs 31:2 & Daniel 3:25, and is used in reference to the Word in Psalm 19:8. The link here is clear. The need for the body & our clothing to bathe in water and soap is a picture of man needing to be covered in the garments of the Word/Jesus.
Psa 24:3 Who shall go up into the hill of YHWH? And who shall rise in His holy place?
Psa 24:4 He who has clean hands and a pure heart; who has not lifted up his soul to vanity and has not sworn deceit.
Psa 24:5 He shall lift up the blessing (berakhah) from YHWH, and righteousness from the God of his salvation.
What is the blessing (berakah)?
Psa 133:3 like the dew of Hermon coming down on the mountains of Zion; for there YHWH commanded the blessing: life till everlasting.
Act 3:25 You are sons of the prophets and of the covenant which God appointed our fathers, saying to Abraham, “Even in your Seed all the families of the earth shall be blessed.“ Gen. 22:18
Act 3:26 Having raised up His child Jesus, God sent Him first to you, blessing you in turning away each one from your iniquities.
This blessing is seen in the natural realm, as described in the book of Hebrews, pointing back to the 3rd day of creation
Heb 6:7 (For the earth drinking in the rain often coming upon it, and producing vegetation suitable for those for whom it is also worked, receives blessing from God;
Heb 6:8 “but bearing thorns and thistles,” it is deemed unfit and near a curse, of which the end is for burning.) Gen. 3:17, 18
Being clothed with His righteousness is linked with the earth springing forth plants
Isa 61:10 Rejoicing I will rejoice in YHWH. My soul shall be joyful in my God. For He clothed me with garments of salvation; He put on me the robe of righteousness, even as a bridegroom dons as a priest his head-dress, and as a bride wears her ornaments.
Isa 61:11 For as the earth comes out with her buds, and as a garden causes that which is sown to grow, so the Lord YHWH will make righteousness and praise to grow before all the nations.
Back to the letter gimmel…
The letter gimmel points to completion, just as the number 3 through does.
Psa 57:2 I will cry to God Most High, to God who works (gamar=perfects) for me.
Psa 138:8 YHWH will perfect His work in me; O YHWH, Your mercy endures forever; You will not forsake the works of Your hands.
This concept of working to perfection through YHWH’s Word/Image being formed in us is seen further in:
2Ti 3:16 All Scripture is God-breathed and profitable for doctrine, for reproof, for correction, for instruction in righteousness,
2Ti 3:17 so that the man of God may be perfected, being fully furnished for every good work.
The Wisdom in the Hebrew Alphabet pg 71
“The גימל gimmel, is cognate to גמל gamol, which means to nourish until completely ripe, as in ויגמל שקדים, it produced mature almonds (Numbers 17:23). Of Isaac, the Torah states: The child grew, ויגמל, and was weaned (Genesis 21:8); there gamol refers to the development of an infant to the point that it can live without it’s mother’s nursing.”
It is interesting to note that in the book of Maccabees the period of time that the mother nursed the child was 3 years.
2Ma 7:27 But she bowing herself toward him, laughing the cruel tyrant to scorn, spake in her country language on this manner; O my son, have pity upon me that bare thee nine months in my womb, and gave thee such three years, and nourished thee, and brought thee up unto this age, and endured the troubles of education.
This concept of maturity being linked with being weaned is further seen in the book of Hebrews
Heb 5:12 For indeed because of the time you are due to be teachers, yet you need to have someone to teach you again the rudiments of the beginning of the Words of God, and you came to be having need of milk, and not of solid food;
Heb 5:13 for everyone partaking of milk is without experience in the Word of Righteousness, for he is an infant.
Heb 5:14 But solid food is for those full grown, having exercised the faculties through habit, for distinction of both good and bad.
Heb 6:1 Because of this, having left the discourse of the beginning of Christ, let us be borne on to full growth, not laying down again a foundation of repentance from dead works, and of faith toward God,
Heb 6:2 of baptisms, of doctrine, and of laying on of hands, and of resurrection of dead ones, and of eternal judgment.
Heb 6:3 And this we will do, if indeed God permits.
Heb 6:4 For it is impossible for those once having been enlightened, and having tasted of the heavenly gift, and becoming sharers of the Holy Spirit,
Heb 6:5 and tasting the good Word of God, and the works of power of a coming age,
Heb 6:6 and having fallen away, it is impossible for them again to renew to repentance, crucifying again for themselves the Son of God, and putting Him to open shame.
Notice that Paul links this concept of maturity with the springing forth of plants and fruit
Heb 6:7 (For the earth drinking in the rain often coming upon it, and producing vegetation suitable for those for whom it is also worked, receives blessing from God;
Heb 6:8 “but bearing thorns and thistles,” it is deemed unfit and near a curse, of which the end is for burning.) Gen. 3:17, 18
To further show this connection, the word for ‘complete/mature’ is

כל is the source for the English word ‘cell.’ This is a fascinating connection as it is the ribosomes which read the amino acids (22 letters) which makes proteins that form our cells.
The Hebrew word for food comes from this same root:

On the 3rd day the plants, trees and fruit appeared which became food for man.
Gen 1:30 And to every beast of the earth, and to all birds of the heavens, and to every creeper on the earth which has in it a living soul, every green plant is for food. And it was so.
Gen 2:9 And out of the ground YHWH God made to spring up every tree that is pleasant to the sight, and good for food. The Tree of Life was also in the middle of the garden; also the Tree of the Knowledge of Good and Evil.
It is interesting that when Isaac was weaned (found mature) there was then a feast (Genesis 21:8). If Isaac was 3 years old, that would connect to the birth of the ‘manchild’ of Revelation 12 & Isaiah 66:7-8, who partakes of the Wedding Supper 3 1/2 years after. Isaac is further linked to the manchild through Psalm 126. When the captivity is ended, our mouths will be full of laughter (sechoq – same root as Yitschaq), Sarah’s barren womb is a picture of Zion (Isaiah 49:13-23; 54:1-3; 66:7-11). It is believed that Isaac was born at Pesach which would link to the ‘manchild’ in Revelation 12 who flees to the wilderness for 3 1/2 years. Subtracting 3 1/2 years from the Fall Feasts which are a picture of Messiah’s return, brings one to the time of Pesach.
The word for bride comes from the same root, כל:

It was on the 3rd day that the bride appeared before YHWH at Mt. Sinai
Exo 19:10 And YHWH said to Moses, Go to the people and sanctify them today and tomorrow. And let them wash their clothes.
Exo 19:11 And be ready* for the third day. For on the third day YHWH will go down before the eyes of all the people on the mountain of Sinai.
*The Hebrew word here is ‘kun’ which means to stand, firm. It comes from the following root word in Hebrew:

This word points to the resurrection and links to the 3rd day of creation. It is on the 3rd day (Hosea 6:2 that the bride is resurrected into the image of Messiah (clothes are cleansed Ephesians 5:26-28) to meet her bridegroom. The Hebrew word for priest, kohen, comes from this root, as the priest is a support/pillar of the community.
‘Kun’ is a picture of a plant rising out of the ground which also links to the Word. Bible & Papyrus.
The words for Bible and Papyrus come from same word in Hebrew ‘אבוב’
E-Word pg 560
‘ABOOBH’ is a hollow pipe or tube derived from jointed reeds or knotgrass, an extension of AiBHeH (reed – Job 9:26).”
This is also the origin of the English word ‘pipe.’ It is no surprise then that the adversary portrays himself as the ‘pied piper’ as seen in the ‘god’ Pan. Pan is equivalent to Saturn as has been discussed in previous studies.
‘Aboobh’ comes from the root אב which is the word for Father.
Going back to the ribosome ‘gum’ connection.
“GUM, sticky resin, was first produced from lakeside plants, thus from אגם, lake, pond. This material was later replaced by the rubber plant, but the GUM name stuck.” (E-Word pg 518) גמא ‘gome’ is the source of the word ‘papyrus’ which is the source for paper and Bible as seen below. Interestingly, the English word ‘syrup’ is also comes from SiRaPH which means gum, resin which traces further back to שרף, mentioned above in connection with ‘sulfur.’ Here we see the negative side of ‘gum’ or ribosomes. The counterfeit who is the seed of the serpent.
DNA Backbone
One strand of DNA has a backbone consisting of a polymer of the simple sugar deoxyribose bonded to something called a phosphate unit.
The nucleotides (letters) of the DNA strand attach to this sugar-phosphate backbone.
These sugar phosphates are based upon the geometry of the number 6. This is a significant number in relation to the mark of the beast study.
There are 4 different types of sugar-phosphates.
Dihydroxyacetone phosphate (DHAP)
Glucose 6-phosphate
Phytic acid
Teichoic acid
The etymology of the words ‘sugar’ and ‘phosphate’ bring forth interesting connections to the current study as well.
Sugar comes forth from the Old French ‘sugar’ which traces back to the Arabic ‘sukkar’ and then to the Hebrew word שכר ‘shakar.’
The word ‘phosphate’ comes from the Latin word ‘phosphorous’ which traces further to the Greek word ‘phosphoros’ which is translated as ‘morning star’ from ‘phos’ meaning light and ‘phoros’ meaning to carry or bear. The Morning Star in Scripture is speaking of Messiah (Revelation 2:28; 22:16) and also the counterfeit ‘Lucifer’ (Isaiah 14:12). Interestingly, modern science has found that DNA contains biophotons and weak proton emissions, a.k.a. light.
Phosphorus ultimately traces back to the Hebrew word פז (paz) which means fine gold (yellow). The link between gold and DNA and the mark of the beast has been discussed throughout this series of studies and will be addressed in more detail below.
Isaac Mozeson’s research into Edenics and the etymology of all languages tracing back to Hebrew brings forth some interesting connections to phosphorus. As seen in the above image, the word ‘topaz’ traces back to ‘paz’ as well.
Sulfur connection
Mozeson traces the English word ‘serpent’ back to the Hebrew word שרף ‘saraph.’ ‘Saraph’ means fiery, burning or to shine. This also is linked to the Hebrew word ‘nachash’ used in Genesis 3 which also has the sense of ‘shining.’
Is it any surprise that those who have had encounters with ‘UFOs’ and the beings associated with them speak of a sulfur smell?
Delving deeper into the etymology of phosphorus and ‘paz’ brings forth even more interesting connections to the current study. ‘Asfar’ the Arabic word for yellow, which comes from the Hebrew ‘paz’ is also a ‘branch’ of the Hebrew word ‘matsebah’ which is usually translated as ‘pillar.’ This is the word used in the Torah in Genesis 28 at Bethel where Jacob encounters the ladder which reaches to heaven and where he anoints the pillar (matstsebah). This ladder is intimately connected to the DNA helix as will be discussed below. The ladder, the pillar etc., all point to Messiah.
The Word is likened unto ‘sugar.’
Psa 135:3 praise Yah! For YHWH is good! Sing praises to His name, for it is delightful.
The word ‘delightful’ in the Hebrew is ‘na’am’ which means pleasant, delightful, beautiful, sweet.
We are to speak the oracles of God (1Peter 4:11)…His Name is His Word (Revelation 19:13) …these are the sweet delicacies that we are to partake of. In nature the same thing can be seen. The sugars of fruits and the sweetness of honey which God created are good for our bodies…the sugars that man created are detrimental.
Sir 24:20 For my memorial is sweeter than honey, and mine inheritance than the honeycomb.
The Memorial is connected w/ the Torah
Psa 19:7 The law of the LORD is perfect, converting the soul: the testimony of the LORD is sure, making wise the simple.
Psa 19:8 The statutes of the LORD are right, rejoicing the heart: the commandment of the LORD is pure, enlightening the eyes.
Psa 19:9 The fear of the LORD is clean, enduring for ever: the judgments of the LORD are true and righteous altogether.
Psa 19:10 More to be desired are they than gold, yea, than much fine gold: sweeter also than honey and the honeycomb. {Notice the connection here between fine gold (paz …phosphorus) and honey (a type of sugar)
Psa 19:11 Moreover by them is thy servant warned: and in keeping of them there is great reward.
Psa 119:103 How sweet are Your Words to my palate! More than honey to my mouth!
Psa 119:104 By Your Precepts I know; so then I hate every false way.
The counterfeit is the ‘sweet’ word of the beast.
Psa 141:3 O YHWH, set a guard to my mouth; keep watch on the door of my lips.
Psa 141:4 Do not let my heart turn aside to any evil thing, to practice deeds in wickedness with men who practice iniquity; and do not let me eat of their delicacies (from ‘na’am).
Psa 140:1 To the chief musician. A Psalm of David. O YHWH, deliver me from the evil man; keep me from the violent man,
Psa 140:2 who devises evil things in the heart; they gather wars all the day.
Psa 140:3 They sharpen their tongues like a snake; adders’ poison is under their lips. Selah.
Pro 5:3 For the lips of a strange woman drip honey, and her palate is sweeter than oil,
Pro 5:4 but afterwards, she is bitter as wormwood, sharp as a sword of mouths;
The Word is likened unto Lightclick here ‘phosphorus’
Psa 119:130 The entering of Your Word gives light, giving discernment to the simple.
His Name is His Word
Rev 19:13 And he was clothed with a vesture dipped in blood: and his name is called The Word of God.
As seen in previous studies, His Name/Word is associated to the mark as this is what will be in the hand/head of His believers (Revelation 14:1; 22:4; Deuteronomy 6:6-8). The mark of the beast is the counterfeit name/word in the hand/head of his followers.
DNA & the Name
Gregg Braden in his book the God Code, speaks of the DNA sequence in man revealing the sacred name of YHWH.
The God Code pg 112
“Through determining their simple mass, the elements of DNA (hydrogen, nitrogen, oxygen and carbon) within our bodies may now be replaced with four letters of the Hebrew alphabet: Yod, Hey, Vav, and Gimel, thus revealing that our DNA may be read literally as a translatable alphabet within each of our cells.”

The God Code pg 136
“When we substitute modern elements for all four letters of God’s ancient name, we see a result that, at first blush, may be unexpected. Replacing the final H in YHVH with its chemical equivalent of nitrogen, God’s name becomes the elements hydrogen, nitrogen, oxygen and nitrogen (HNON) – all colorless, odorless, and invisible gases! In other words, replacing 100 percent of God’s personal name with the elements of this world creates a substance that is an intangible, yet very real form of creation!”
“Additionally, the first chapters of Genesis relate that it is in a nonphysical form that the Creator was present during the time of creation (Genesis 1:2). It was the ‘spirit of God’ that first moved over the face of the earth.”
“The Sepher Yetzirah further describes the first Hebrew letter to emerge from the void of creation as the Mother Letter that made the universe possible: Alef. Through a great, mystical ‘secret’ Alef then evolved into the first element to appear in our universe, hydrogen, as well as the first letter of God’s name : Yod.”
Joh 5:43 I have come in the name of My Father, and you do not receive Me. If another comes in his own name, you will receive that one.

Jesus came in the likeness of man YHVG, but also in the Name of the Father YHWH. It is interesting that Jesus in Greek = 888. The man of sin = 666.
Bodies & Books
Our bodies are pictured by books.
Psa 40:7 Then said I, Lo, I come: in the volume of the book it is written of me,

‘Tome’ is the root of the word anatomy

In the same passage of Scripture mentioned above in reference to Messiah, it speaks of the body being given to Him.
Heb 10:5 For this reason, coming into the world, He says, “Sacrifice and offering You did not desire, but You prepared a body for Me.
Heb 10:6 You did not delight in burnt offerings and sacrifices concerning sins.”
Heb 10:7 “Then I said, Lo, I come, in the heading*** of the Book (Biblion) it was written concerning Me, to do Your will, O God.” LXX-Psa. 39:7 -9; MT-Psa. 40:6 -8
***G2777
κεφαλίς
kephalis
Thayer Definition:
1) a little head
2) the highest part, extremity of anything
2a) as the capital of a column
2b) the tips or knobs of the wooden rod around which parchments were rolled were called by this word, because they resembled little heads
3) the Alexandrian writers transferred the name to the roll or volume itself
3a) in the roll of the book
Part of Speech: noun feminine
A Related Word by Thayer’s/Strong’s Number: from G2776
In Hebrew this word is ‘megillah’ which is also related to the ‘head’. The word golgolet (Golgotha/skull) comes from this same root in Hebrew meaning round. The word ‘megillah’ is related to the Hebrew word ‘galgal’ (circle) which has the gematria of 66, referring back to the 66 books of the Word.
The word for ‘chapter’, also means a ‘head’ from the Latin capitulum.
Traditionally, Torah scrolls were treated like living beings. They were clothed and when they wore out they were buried. The armor worn by a man (specifically speaking of Messiah) as mentioned in Isaiah 59:13; Ephesians 6:11 corresponds with the clothing of a Torah Scroll. The Armor of God is linked with baptism in Messiah Armor of Elohim

The word in Greek for armor is ‘panoplia’ which is used to translate the Hebrew word ‘chalatz’ in the Septuagint

Going back to the word anatomy, as seen above it used to be a synonymous word with ‘skeleton.’

Notice that the word skeleton traces back to the meaning of ‘dried up.’ This links to the current study through the word for ‘dry land’ (yabesh). Interestingly, the body of Messiah is likened to dry bones העצמות היבשׁות in Ezekiel 37 which is resurrected and brought back to the land of Israel.
The word for bone in Hebrew comes from the word עץ meaning a tree…it is no coincidence that Ezekiel 37 speaks of bones in reference to the resurrected body of Messiah and then speaks of 2 trees becoming one in reference to His body.

There are 206 bones in the human skeleton. Here are a few times that the gematria of 206 is seen in the Scriptures. Notice the connections to the current study.


The etymology of the word codex comes from a block of wood.

In the 5th century, Isidore of Seville explained the relation between codex, book and scroll in his Etymologiae (VI.13): “A codex is composed of many books; a book is of one scroll. It is called codex by way of metaphor from the trunks (codex) of trees or vines, as if it were a wooden stock, because it contains in itself a multitude of books, as it were of branches.”
Those who are reborn in Messiah will be in His image. Walking Torah Scrolls.
2Co 3:3 it having been made plain that you are Christ’s letter, served by us, not having been inscribed by ink, but by the Spirit of the living God, not in tablets of stone, but in fleshly tablets of the heart.
The word for letter above is the Greek word Epistole (Epistle) which comes from the Hebrew word אגרת. In Hebrew אגר means to gather and the letter tav means the cross/covenant. 2 Corinthians 3:3 describes the New covenant (Jeremiah 31:31; Hebrews 8:8; 10:16; Ezekiel 11:16-20; 36:26). Interestingly, אגר comes from the root גר which literally means a ‘walking man.’ It is translated as a sojourner, traveler, and as a stranger (Genesis 17:8; 47:9; Leviticus 25:23; Psalm 39:12; 1 Peter 2:11; 1:17; Hebrews 11:9, 13-16; 13:14).
Interestingly, the word for ink in 2 Corinthians 3 is from the Greek word melan
G3188
μέλαν
melan
Thayer Definition:
1) ink
Part of Speech: noun neuter
A Related Word by Thayer’s/Strong’s Number: from G3189 as noun
This is the root word for ‘melanin’, that which is found in the skin which brings forth the various colors.
Who is the one that writes on the hearts of the living epistles with the ink of the Spirit? Messiah, who is putting the Mark of YHWH on the foreheads of the righteous. Notice here that the man with the inkhorn is one among 7…
Eze 9:2 And, behold, six men were coming from the way of the Upper Gate, which faces north. And each had his shattering weapon in his hand. And one man among them was clothed in linen, and an ink horn of a scribe at his loins. And they went in and stood beside the bronze altar.
Eze 9:3 And the glory of the God of Israel had gone on, from on the cherub where it was on it, to the threshold of the house. And He called to the man clothed in linen with the ink horn of a scribe at his loins.
Eze 9:4 And YHWH said to him, Pass through in the midst of the city, in the midst of Jerusalem, and mark a mark on the foreheads of the men who are groaning and are mourning over all the abominations that are done in her midst.
Here we see an inkhorn instead of a sword. This links with the armor of God mentioned above as the Word is the Sword of the Spirit. (Ephesians 6:17; Hebrew 4:12).
Going even deep into this connection between men and books is DNA.
‘Jacob’s Ladder’
The ladder
Gen 28:11 And he came on a place and stayed the night there, for the sun had gone. And he took stones of the place and placed them at his head; and he lay down in that place.
Gen 28:12 And he dreamed. And, behold, a ladder was placed on the earth, its top reaching to the heavens. And, behold, the angels of God were going up and going down on it!
Gen 28:17 And he was afraid, and said, How fearful is this place! This is nothing except the house of God, and this is the door to Heaven.
Gen 28:18 And Jacob started up early in the morning and took the stone which he had placed at his head, and he placed it as a pillar; and he poured oil on the top of it.
Gen 28:19 And he called the name of that place, The House of God {Bethel}. And yet the name of the city was at first Luz.
The ladder = Messiah
Joh 1:51 And He says to him, Truly, truly, I say to you, From now on you will see Heaven opened, and “the angels of God ascending and descending” on the Son of Man.
Messiah Jesus= the Word
Joh 1:1 In the beginning was the Word, and the Word was with God, and the Word was God.
DNA – Ladder

DNA & Languageclick here
Nucleotide Character (Letter)
Codon Letter
Gene Word
Operon Sentence
Regulon Paragraph
DNA Book
Simplified it could be said
Nucleotide bases Letters
Codons Words
Genes Sentences
Book DNA
DNA is a message from God. The DNA molecule is just the carrier. Similar to the Torah. The Torah is YHWH…the scrolls and books on which it is written is the carrier.
This is further seen in the ‘epigenome.’ The Epigenome tells the cell how to ‘translate’ the DNA code. All of the parts of our bodies have the same genetic code, it is the Epigenome that tells whether the cell is going to be a skin, hair, eye etc cell. This corresponds to the Holy Spirit. The Scriptures can be read by anyone yet it is only through the Holy Spirit that one can understand and see the ‘image’ of God. His Image is not seen through signs and symbols created by man, but only through the Holy Scriptures.
Messiah, who is the Word, is the only Image of YHWH. The religious symbols carved out by man are counterfeits.
Heb 1:1 In many ways and in various ways of old, God spoke to the fathers in the prophets;
Heb 1:2 in these last days He spoke to us in the Son, whom He appointed heir of all; through whom He indeed made the ages;
Heb 1:3 who being the shining splendor of His glory, and the express image of His essence, and upholding all things by the Word of His power, having made purification of our sins through Himself, He sat down on the right of the Majesty on high, Psa. 110:1
‘Express image’ in the above verse comes from the following Greek word:
G5481
χαρακτήρ
charaktēr
Thayer Definition:
1) the instrument used for engraving or carving
2) the mark stamped upon that instrument or wrought out on it
2a) a mark or figure burned in (Lev_13:28) or stamped on, an impression
2b) the exact expression (the image) of any person or thing, marked likeness, precise reproduction in every respect, i.e facsimile
Part of Speech: noun masculine
A Related Word by Thayer’s/Strong’s Number: from the same as G5482
As can be seen in part 1click here, this word traces back to the word for the mark in Revelation 13. ‘Charaktēr’ comes from ‘charax’ which is used in the Septuagint to translate multiple words, one of which is highly significant in connection with ‘Jacob’s ladder,’ the pillar & image.
charax H4674 mutstsav
As explained in part 1click here, the mark is associated with an image & a garrison. It was at Bethel (House of God) that Jacob anointed the pillar where the ladder to heaven was seen (Genesis 2812-19):. Jacob’s pillar is connected with the ladder to Heaven. Messiah applies this to Himself (John 1:51). The ladder also points to DNA within our bodies which is the ‘word’ that creates our bodies. Messiah is the Word made flesh who is the olive tree/tree of lifeclick here which we can be grafted into through faith. He is the body, we are members of that body through faith. He is the Temple, we are the stones of the building by faith.
Satan seeks to be like the Most High {Isaiah 14} and is the great counterfeiterclick here. Hence, he wants a false Olive tree/tree of knowledge of good and evil. He wants a false temple. A ‘false’ body. A corrupted body. A false Israel. A corruption of DNA/the word.
As George Williams puts it: “The gene is a package of information, not an object. The pattern of base pairs in a DNA molecule specifies the gene. But the DNA molecule is the medium, it’s not the message”
The DNA molecule is the instruction manual for the forming of amino acids which are made are the structural elements of proteins that turn into the biochemical units that drive all biological processes. There are only 22 amino acids found in proteins. Certain proteins are called enzymes. They are catalysts (agents that are necessary for a reaction to occur but are not themselves changed in the process); others are called structural proteins which help to build cells and tissues.
If DNA can be thought of as the language of life, then the four bases can be seen as letters and the codons as arrangements of letters, or words. But like English, DNA’s language is more than words. Some codons function as punctuation marks, containing instructions to stop or start manufacturing a protein. This chemically simple yet stunningly complex DNA molecule dictates not only what proteins the organism will be made of, but how these proteins are to be arranged.
We have seen that one codon contains the instructions for one amino acid, and that sequences of codons specify the production of proteins. Groups of codons that have been arranged in “grammatically” correct sentences to form specific proteins are called “genes”.
DNA contains all the information needed to perpetuate life. This information builds in complexity from nucleotides to codons to genes, ultimately giving the complete text to form the body.
The word sign/symbol traces back to the Greek word ‘sememe’ (smallest part of a word) which traces back further to ‘semen’ which means seed in Latin.
The smallest part of a word is called ‘Sememe’ from same root as Semen (seed/DNA).
root sem=sign in Greek (semiology=study of signs)
English word seed is from Hebrew word sod (mystery/secret).
Hebrew word for sign is אות, which is the same word for ‘letter(s)’ in Hebrew.
אות ot=aleph vav tav also translated as a miracle from the root aleph tav.
As seen in part 1click here, the word אות is the same word translated as ‘mark.’
Again we see that language (words) are comparable to signs/symbols and DNA.
Rev 1:1 A Revelation of Jesus Christ, which God gave to Him to show to His slaves things which must occur quickly. And He signified (Greek semaino=signed) by sending through His angel to His slave, John,
Exo 18:20 And you warn them as to the statutes and the laws, and make known (Greek semaino = Hebrew yada*)to them the way in which they should walk, and the work which they should do.
*This word means to know intimately, as in a man ‘knowing’ his wife. Here we see that the word semaino (sign in Greek) is associated with procreation. When a man and woman bring forth a child it is through their combination of DNA that the child gets its ‘image.’
Blood (DNA) =image, resemblance


In Isaiah 14, Lucifer is described as desiring to be like the Most High. This word ‘like’ is the same word above, ‘damah.’
Heb 3:14 For we have become partakers* of Christ, if truly we hold the beginning of the assurance firm to the end;
The word partakers here is μέτοχος ‘metochos.’ This is used to translate three words in the Septuagint. One is ‘bachar’ which means ‘chosen.’ This is the true definition of the chosen people. For the connection to the mark see part 11 on Zionismclick here. The second word is ‘chaber.’ This is the word for friend or companion as those who are ‘joined’ to each other. This is the word used for the joining together of the Tabernacle which is a picture of the body of Messiah. The third word used is ‘damim’ which comes from the above word ‘dam’ (blood).
First the natural, then the spiritual
1Co 15:44 It is sown a natural body, it is raised a spiritual body; there is a natural body, and there is a spiritual body.
1Co 15:45 So also it has been written, “The” first “man”, Adam, “became a living soul;” the last Adam a life-giving Spirit. Gen. 2:7
1Co 15:46 But not the spiritual first, but the natural; afterward the spiritual.
1Co 15:47 The first man was out of earth, earthy. The second Man was the Lord out of Heaven. Gen. 2:7
1Co 15:48 Such as is the earthy man, such also are the earthy ones. And such as is the heavenly Man, such also are the heavenly ones.
1Co 15:49 And as we bore the image of the earthy man, we shall also bear the image of the heavenly Man.
DNA is a picture of the Word in the natural. The Tabernacle = our bodies.
2Co 6:16 And what agreement hath the temple of God with idols? for ye are the temple of the living God; as God hath said, I will dwell in them, and walk in them; and I will be their God, and they shall be my people.
1Co 3:16 Know ye not that ye are the temple of God, and that the Spirit of God dwelleth in you?
1Co 3:17 If any man defile the temple of God, him shall God destroy; for the temple of God is holy, which temple ye are.
Joh 2:19 Jesus said to them, Destroy this sanctuary, and in three days I will raise it up.
Joh 2:20 Then the Jews said, This sanctuary was forty six years being built, and do You raise it up in three days?
Joh 2:21 But He spoke about the sanctuary of His body.
The Temple/Tabernacle = the Body
Exo 25:8 And let them make a sanctuary for Me, that I may dwell in their midst.
2Co 6:16 And what agreement hath the temple of God with idols? for ye are the temple of the living God; as God hath said, I will dwell in them, and walk in them; and I will be their God, and they shall be my people.
1Co 3:16 Know ye not that ye are the temple of God, and that the Spirit of God dwelleth in you?

The body = the Tabernacle. The Holy of Holies =the cell. The ark of the covenant = the nucleus of the cell. The Word was placed inside the ark, DNA is inside the nucleus. Man was created in the image of God. Specifically, believers in Jesus are created in His image and are now sons of GodHere. Satan seeks to counterfeit this by creating people in his image. The mixture of the sons of God and the daughters of men. The mark of YHWH is His Word. The mark of the beast is a counterfeit word…
Psa 139:16 Your eyes saw my embryo; and in Your book all my members were written the days they were formed, and not one was yet among them.
The adversary’s desire is always to enter YHWH’s secret place, hidden place…His Temple.
Eze 7:22 I also will turn My face from them, and they shall defile My hidden (KJV secret) place. And violent ones shall enter into it and defile it.
The Holy of Holies contained the ark of the covenant which had the Word within. Our cells contain our DNA which is a physical picture of that Word.
The womb is secret
Psa 139:15 My bones were not hidden from You when I was made in secret; when I was woven* in the depths of the earth.
*רקם
râqam…this words means fashion, needlework or twisted threads (DNA).
Psa 139:16 Your eyes saw my embryo; and in Your book all my members were written the days they were formed, and not one was yet among them.
Psa 139:17 And how precious are Your thoughts to me, O God! How great is the sum of them!
The Olive tree = His Body = the Pillar/Bethel
Romans 11:16 the Root of the Olive Tree = Messiah
Rom 11:16 Now if the firstfruit is holy, so also the lump. And if the root is holy, so also the branches.
Isa 6:13 But yet in it shall be a tenth, and it shall return, and shall be eaten: as a teil tree, and as an oak, whose substance{H4678matstsebeth a monumental stone; also the stock of a tree: – pillar, substance.} is in them, when they cast their leaves: so the holy seed(Gal 3:16) shall be the substance(H4678 ROOT) thereof.
ROOT=MATSTSEBETH = PILLAR
Gen 28:10 And Jacob went out from Beersheba, and went toward Haran.
Gen 28:11 And he lighted upon a certain place, and tarried there all night, because the sun was set; and he took of the stones of that place, and put them for his pillows, and lay down in that place to sleep.
Gen 28:12 And he dreamed, and behold a ladder set up on the earth, and the top of it reached to heaven: and behold the angels of God ascending and descending on it.
Gen 28:16 And Jacob awaked out of his sleep, and he said, Surely the LORD is in this place; and I knew it not.
Gen 28:17 And he was afraid, and said, How dreadful is this place! this is none other but the house of God, and this is the gate of heaven.
Gen 28:18 And Jacob rose up early in the morning, and took the stone that he had put for his pillows, and set it up for a pillar{H4678 matstsebeth}, and poured oil upon the top of it.
Gen 28:19 And he called the name of that place Bethel {H1008 house of God}:: but the name of that city was called Luz* at the first.
Gen 28:20 And Jacob vowed a vow, saying, If God will be with me, and will keep me in this way that I go, and will give me bread to eat, and raiment to put on,
Gen 28:21 So that I come again to my father’s house in peace; then shall the LORD be my God:
Gen 28:22 And this stone, which I have set for a pillar, shall be God’s house: and of all that thou shalt give me I will surely give the tenth {Isaiah 6:13} unto thee.
*Luz is linked to the spinal column, as mentioned above in connection with ‘Kundalini.’
In My Flesh I see God pg 179
“Relates the Midrash: The Roman emperor Hadrian once asked Rabbi Yehoshua ben Chananiah, ‘From which part of the body will God make man sprout forth when the dead are revived?’
He replied, ‘From the luz bone of the spinal column.'”
Gen 35:14 And Jacob set up a pillar(H4678 matstsebeth) in the place where he talked with him, even a pillar of stone: and he poured a drink offering thereon, and he poured oil thereon.
Gen 35:15 And Jacob called the name of the place where God spake with him, Bethel{H1008 בּית־אלbeytḣ’el house of God}
Mat 16:18 And I say also unto thee, That thou art Peter, and upon this rock I will build my church; and the gates of hell shall not prevail against it.
1Ti 3:15 But if I tarry long, that thou mayest know how thou oughtest to behave thyself in the house of God, which is the church of the living God, the pillar and ground of the truth.
Eph 2:19 Now therefore ye are no more strangers and foreigners, but fellowcitizens with the saints, and of the household of God;
Eph 2:20 And are built upon the foundation of the apostles and prophets, Jesus Christ himself being the chief corner stone;
Eph 2:21 In whom all the building fitly framed together groweth unto an holy temple in the Lord:
Eph 2:22 In whom ye also are builded together for an habitation of God through the Spirit.
This is interesting to note. Jacob’s pillar is connected with the ladder to Heaven. Messiah applies this to Himself. The ladder also points to DNA within our bodies which is the ‘word’ that creates our bodies. Messiah is the Word made flesh who is the olive tree/tree of life which we can be grafted into through faith. He is the body, we are members of that body through faith. He is the Temple, we are the stones of the building by faith. Satan seeks to be like the Most High {Isaiah 14} and is the great counterfeiter. Hence, he wants a false Olive tree/tree of knowledge of good and evil. He wants a false temple. A ‘false’ body. A corrupted body. A false Israel. A corruption of DNA/the word.
Going back to Genesis 28 and the word ‘matstsebeth,’ it is interesting to note that this word further connects to the Tree of Life through Isaiah 6:13. Isaiah 6:13 is referring to the root of the Olive tree of Israel, who is Messiahclick here.
Rom 11:16 For if the firstfruit (1Cor 15:52) be holy, the lump is also holy: and if the root (Isa 6:13; Gal 3:16) be holy, so are the branches (Joh 15:5).
Trees & Men
The Hebrew word for tree is:

The elders/mature are likened to trees.

Who is our Counselor?
Isa 9:6 For a Child is born; to us a Son is given; and the government is on His shoulder; and His name is called Wonderful, Counselor, The Mighty God, The Everlasting Father, The Prince of Peace.
The same word for counselor is the same word for spine

The English word spine comes from the Latin word Spica

Spica points directly to the Messiah as seen in the constellation of Virgo. In the hand of the Virgin is a sheaf of wheat with 5 stars. A virgin (Is. 7:14) holding a branch (Jer. 23:5-6) and an ear of corn. Corn = seed (Latin Spica, the modern name of this bright star. Old name was Arabic Al Zimach seed). Star Zavijaveh means “gloriously beautiful” (Is. 4:2). Zimach in Arabic refers back to the Hebrew ‘tsemach’, seen above, which is used 5 times in reference to the Messiah.
The 33 bones in the human spine correspond to the 33 years of the life of Messiah. The link between the back and Messiah is further seen in Exodus 33 where Moshe is shown the glory of YHWH, specifically mentioning His back.
Exo 33:22 And as My glory is passing it will be that I will put you in a cleft of the rock; and I will cover My hand over you during My passing.
Exo 33:23 And I will remove My hand, and you shall see My back; but My face cannot be seen.
Trees – Books
The English word book comes from the Old English ‘boc’ which derives from the Germanic root ‘bok’ which is a cognate of beech. Beech was a common writing material in Germanic societies before the development of paper.
A single sheet within a book is called a leaf. Each side of the leaf is called a page.

A folio has similar meaning

Papyrus, a thick paper-like material made by weaving the stems of the papyrus plant, then pounding the woven sheet with a hammer-like tool.
As seen above, Exodus 2:2 speaks of the papyrus basket/ark that Moshe was placed in at the Nile…
Parchment, papyrus connection – hammering out…
Interestingly, the word for parchment is used in the New Testament (2 Timothy 4:13) as a translation of the Greek word membrane.
Whitaker’s Latin Dictionary
Membrana, Membranae
N – 1 1 – F –
membrane; skin; parchment;
Thin skin, film membrane. The skin of a snake or the skin prepared to write on a parchment like a scroll.
As seen in previous studiesclick hereclick here , the heavens were hammered out and likened to a scroll. Recent scientific theories liken the universe to a membrane as well. It is believed that our bodies are being held together by a membrane known as laminin as well.
Papyrus sheets were glued together to form a scroll. Tree bark such as lime (Latin liber).
Lime is an altered form of Middle English lind, in the 16th century also line, from Old English feminine lind or linde, Proto-Germanic *lendā, cognate to Latin lentus “flexible” and Sanskrit latā “liana”. Within Germanic languages, English lithe, German lind “lenient, yielding” are from the same root.
Linden was originally the adjective, “made from lime-wood” (equivalent to “wooden”), from the late 16th century “linden” was also used as a noun, probably influenced by translations of German romance, as an adoption of Linden, the plural of German Linde.[1] Neither the name nor the tree is related to the citrus fruit called “lime” (Citrus aurantifolia, family Rutaceae).
The Linden tree in Scripture. The following passage of Scripture is speaking of the remnant of Israel, the olive tree who are in the image and likeness of Messiah.
King James Version
Isa 6:13 But yet in it shall be a tenth, and it shall return, and shall be eaten: as a teil tree (elah), and as an oak (allon), whose substance (matstsebeth) is in them, when they cast (shalakh – from shel mentioned above) their leaves: so the holy seed shall be the substance (matstsebeth – pillar,rootBethel)thereof.
Keil & Delitszch commentary
It shall happen as with the terebinth and oak. These trees were selected as illustrations, not only because they were so near akin to evergreens, and produced a similar impression, or because there were so many associations connected with them in the olden times of Israel’s history; but also because they formed such fitting symbols of Israel, on account of their peculiar facility for springing up again from the root (like the beech and nut, for example), even when they had been completely felled. As the forms yabbesheth (dryness), dalleketh (fever), ‛avvereth (blindness), shachepheth (consumption), are used to denote certain qualities or states, and those for the most part faulty ones (Concord. p. 1350); so shalleceth here does not refer to the act itself of felling or casting away, but rather to the condition of a tree that has been hewn or thrown down; though not to the condition of the trunk as it lies prostrate upon the ground, but to that of the root, which is still left in the earth. Of this tree, that had been deprived of its trunk and crown, there was still a mazzebeth kindred form of mazzebâh), i.e., a root-stump (truncus) fast in the ground. The tree was not yet entirely destroyed; the root-stump could shoot out and put forth branches again. And this would take place: the root-stump of the oak or terebinth, which was a symbol of Israel, was “a holy seed.” The root-stump was the remnant that had survived the judgment, and this remnant would become a seed, out of which a new Israel would spring up after the old had been destroyed (Matthew 3:10). Thus in a few weighty words is the way sketched out, which God would henceforth take with His people. The passage contains an outline of the history of Israel to the end of time. Israel as a nation was indestructible, by virtue of the promise of God; but the mass of the people were doomed to destruction through the judicial sentence of God, and only a remnant, which would be converted, would perpetuate the nationality of Israel, and inherit the glorious future. This law of a blessing sunk in the depths of the curse actually inflicted, still prevails in the history of the Jews. The way of salvation is open to all. Individuals find it, and give us a presentiment of what might be and is to be; but the great mass are hopelessly lost, and only when they have been swept away will a holy seed, saved by the covenant-keeping God, grow up into a new and holy Israel, which, according to Isa_27:6, will fill the earth with its fruits, or, as the apostle expresses it in Rom_11:12, become “the riches of the Gentiles.”
For more on this Olive Tree ; Netsarim
Literal Version
Isa 6:13 But yet a tenth shall be in it, and it shall return and be consumed like the terebinth and like the oak that in being felled yet has its stump (the holy seed is its stump).
Treasury of Scripture Knowledge
teil tree: The teil-tree is the linden or lime-tree, a species very common in Palestine; the leaf of which resembles that of the laurel, and its flower that of the olive. But the original ailah which our translators render the oak (but here distinguished from allon the oak)
The word for teil tree/linden tree in Hebrew is ‘elah’ which comes from the root ‘el’ which is commonly translated as God.

The Scrolls were held together by lime/linden trees. This is seen in creation as well. It is Messiah who is holding all things together (Colossians 1:17). The Greek word used in Colossians 1:17 is sunistemi which translates back to the Hebrew word tseba. Tseba comes from the same root as matstsebah mentioned above, the House of El.
Col 1:17 And He is before all things, and all things have subsisted (G4921 συνέστηκε) in Him.
His Word is holding all things together. Interestingly, one of the Hebrew words for ‘word’ is amar. What is the meaning of amar? Thoughts that are bound together. Amar comes from the following root word:

Liber
In Latin Liber means a book, bark of a tree, treatise, letter
from Latin, in original sense: tree bark]
Liber is also a rare name for phloem
Phloem
A tissue in vascular plants that conducts food from the leaves and other photosynthetic tissues to other plant parts.
In vascular plants, phloem is the living tissue that carries organic nutrients (known as photosynthate), particularly sucrose, a sugar, to all parts of the plant where needed. In trees, the phloem is the innermost layer of the bark, hence the name, derived from the Greek word φλόος (phloos) “bark”. The phloem is concerned mainly with the transport of soluble organic material made during photosynthesis. This is called translocation.
Interestingly, when looking at the cross section of a tree from the the tilia genus (such as the linden tree mentioned above), it is seen that it is divided into 7 sections…just like the Menorah

Interestingly, flax has this same division.

The word in Hebrew for flax links to the menorah as well. Flax was made into linen which then became wicks for lamps (menorot). Connecting flax to the current topic further, the root word for linden comes from ‘li’ which in the Indo-European language means flax. This would make *len (linden) an extension of the flax root meaning ‘flexible as threads made of flax,’ then of rope or cord made of other materials, like the inner bark of the linden.

the Menorah = the Word = the Tree of Life = the Olive Tree = the Body of Messiah…

Click picture for more details on how the Scriptures are in the form of a Menorah…
It is interesting to note as well, that the natural ecology of forests is divided into 7 sections.
1. The canopy
2. Low tree layer (dwarf fruit trees)
3. Shrubs
4. Herbaceous
5. Rhizosphere (root crops)
6. Soil surface (cover crops)
7. Vertical layer (climbers, vines)

The more diverse and complex an ecosystem is, the more stable it is.
Rom 12:4 For even as we have many members in one body, but all members do not have the same function,
Rom 12:5 so we the many are one body in Christ, and each one members of one another,
Back to the word Liber…
Interestingly, If one looks at Latin versions of the TaNaKH, one will see that the 5 books of the Torah are headed with only their names. Genesis, Exodus, Leviticus, Numeri, Deuteronicum.
The books that follow always have the prefix of Liber, Liber Jehoshua, Liber Judicum etc.

The Torah is the root and the other books are the branches that carry the ‘food’. Messiah is the vine/root, His body are the branches… Food in Hebrew is lechem (bread).
Bread in Greek is artos which is used to translate numerous words in Hebrew. Lechem, dagan (grain/fish ie believers), challah (from root chol…sand ie believers), and also ‘pat’.

Isa 8:18 Behold, I and the children (Messiah & His Body) whom YHWH has given to me are for signs and wonders (mophat) in Israel from YHWH of Hosts, who dwells in Mount Zion.
Amazingly, the Latin word liber also means children…
liber
N 2 3 M P
children (pl.); (sg. VOC) child.
Going back to the link between Liber & bread, the Scriptures liken the Word/Torah to bread (Deuteronomy 8:2-3; Matthew 4:2-4; John 6:30-63). Messiah equates the manna/bread from heaven with Himself in John 6. Manna is also referred to as dew in the TaNaKH (Exodus 16:13-14; Numbers 11:9, Torah is likened to dew (Deuteronomy 32:2), YHWH is likened to dew (Hosea 14:5).
Deu 8:3 And He has humbled you, and caused you to hunger, and caused you to eat the manna, which you had not known, and your fathers had not known, in order to cause you to know that man shall not live by bread alone, but man shall live by every Word that proceeds* from the mouth of YHWH.
The word for proceed in Hebrew is ‘motsa’ which means to spring forth or bud.

This word is related to the Hebrew word for Apostle (sholiach) which comes from the word ‘shalach’ which means to send forth, as the shoots of a plant. The Hebrew word for table also comes from this root. On the table of shewbread/bread of presence in the Tabernacle/Temple there were 12 loaves of bread representing the 12 tribes. It is the job of His branches, His apostles to take the bread of life to the world. This bread of life is His Word, the Messiah, His presence.
The word Bible comes from papyrus…
The Greek word for papyrus as writing material (biblion) and book (biblos) come from the Phoenician port town Byblos, through which papyrus was exported to Greece.
From Greek we also derive the word tome (Greek: τόμος), which originally meant a slice or piece and from there began to denote “a roll of papyrus”. Tomus was used by the Latins with exactly the same meaning as volumen which means a roll/scroll.
The volume of the Scroll is written about Messiah
Psa 40:7 Then said I, Lo, I come: in the volume of the book it is written of me,
As seen above this verse is linked to the coming of the Messiah in a body. Here we see the human body linked with trees and the Word. There were two trees in the midst of the Garden. The tree of Life who is Messiah who is the Word made flesh. The tree of knowledge of good and evil who is the antichrist beast who is the word of lawlessness made flesh. Mankind has two choices. Life or death, blessing or cursing.
Interestingly, roll(s) are mentioned 23 times in the Scriptures corresponding to the 23 chromosomes in the human body.
Chromosomes
In the egg cell of the woman is 22 autosomes and 1 sex chromosome. In the sperm cell of the man is 22 autosomes and 1 sex chromosomes. In order for life to be created, there needs to be 46 chromosomes.
The Holy Scriptures are a combination of the Hebrew and Greek languages. The Hebrew language consists of 22 letters and the Greek language consists of 24. The total is 46.
The sperm cell in and of itself cannot produce life and neither can the egg cell of the woman. These must be combined. The seed is the Word (Luke 8:11). The seed is carried by the man. Here is the picture of the Letter of law which is dead in and of itself (2 Corinthians 3:6). It is only when the Spirit (‘ruach’ in Hebrew is a feminine word) is added to the Word that life is brought forth.
The egg cell is carried by the woman but without the seed (the Word) it does not bring forth life either. The Hebrew word for egg is ‘betsah’ which traces back to the word for house/temple ‘beyit.’ Without the Word in our bodies (temples) we are dead. We must be born again through the incorruptible seed of the Word of God (1Peter 1:23; Titus 3:5; 1John 3:9; James 1:18). This is the fruit of the Tree of Life, whose seed is in itself.
Chromosomes are in the shape of an x or cross. The male carries the X and Y chromosome, the female carries only the X. The letter X is the Hebrew letter Tav which means a covenant or mark. The letter Y is the Hebrew letter vav. תו is the Hebrew word for mark as seen above. Again the link between genetics and the mark is seen.
Etymology
Chromosome comes from the Greek word ‘khroma’ meaning color/skin and ‘soma’ meaning body. Chromosomes were given this name because of the ability to be stained underneath a microscope.
In Hebrew this is qaram which is a switching for raqam which is a word that means ‘twisting of thread‘ (DNA). Qaram means a covering as seen in Ezekiel 37:6
Eze 37:6 and I will put on you sinews and will bring flesh on you and spread skin over you and put breath in you, and you shall live. And you shall know that I am YHWH.
Ezekiel 37 is an interesting connection to the above discussion on the seed and the egg. This chapter is speaking of the dry bones which are brought back together but don’t have life until the wind (ruach-spirit) is breathed into them. Bones are from the same word as trees (which makes another interesting connection in the same chapter on the two sticks) which as seen above is linked to the Word. The Word is ‘dead’ without the Spirit.
Going back to the etymology of chromosome…
Chromosome traces back to the Hebrew word ‘qaram.’
‘Qaram’ means to spread or lay over. It comes from the root רק which means a ‘gathering of heads/people.’ This word is associated with gatherings of people such as cities, assemblies etc. It is the word used for a gathering of believers to read the Word and worship the most High. To ‘qara’ call upon His Name. This is the root of the word ‘miqra’ or ‘miqra qodesh’ speaking of the gatherings at the Sabbaths spoken of in Leviticus 23. These feasts are commonly referred to as statutes in the Scriptures which comes from the word חק ‘chuq.’ ‘Chuq’ has an interesting connection to chromosomes. The word ‘chuq’ literally means to divide/separate and then come together. Interestingly, chromosomes are only visible during the dividing of a cell which in reality is a multiplying of the cell.
Messiah came to divide Israel (Matthew 10:35; Luke 3:7-9) but in reality brought more people unto Himself through the cross (x in the same shape as the chromosome) (John 10:16; 12:32).
1Co 1:18 For the Word of the cross is foolishness to those being lost, but to us being saved, it is the power of God.
1Co 1:23 we, on the other hand, preach Christ crucified (truly an offense to Jews, and foolishness to Greeks),
1Co 1:24 but to the called out ones, both to Jews and to Greeks, Christ is the power of God and the wisdom of God;
Τhe Greek word kroma, κρῶμα means surface of body, skin, skin color, color and is related to the word grit. Grit has the meaning of tiny particles of crushed rock, sand {sand is an amazing shadow picture of Messiah & His bodyclick here}, dust, gravel. This has interesting parallels in regards to man coming from the dust/earth. On one level this is speaking of the elements of the earth from whence Adam was made but here it is seen in relation to the chromosomes.
The God Code – Gregg Braden pg 84
“Through studies such as the IGY (International Geophysical Year), we now know that relatively few elements compose most of the earth’s outer crust, including the layers beneath the oceans. Silicon, oxygen, hydrogen, and aluminum amount for more than 90 percent of the composition of this layers. Of even greater significance is the discovery that two of those four elements – hydrogen and oxygen – also account for more than 99 percent of our bodies as well!”
Man is further linked to the earth in the word for man (adam), and the word for ground (adamah).

Adam/adamah comes from the root:


From one blood all mankind comes forth. In Adam, all the colors of the dust dwelled.
Act 17:26 And He made every nation of men of one blood, to live on all the face of the earth, ordaining fore-appointed seasons and boundaries of their dwelling,
Act 17:27 to seek the Lord, if perhaps they might feel after Him and might find Him, though indeed He not being far from each one of us.
Act 17:28 For in Him we live and move and exist, as also some of the poets among you have said, For we are also His offspring.
In the 2nd Adam (1 Corinthians 15:47), there is no difference in color, race, etc.
Col 3:10 and having put on the new, having been renewed in full knowledge according to the image of the One creating him,
Col 3:11 where there is no Greek and Jew, circumcision and uncircumcision, foreigner, Scythian, slave or freeman, but Christ is all things and in all.
Col 3:12 Therefore, as elect ones of God, holy and beloved, put on a heart of compassions, kindness, humility, meekness, long-suffering,
Rom 10:12 For there is no difference both of Jew and of Greek, for the same Lord of all is rich toward all the ones calling on Him.
Gal 3:26 for you are all sons of God through faith in Christ Jesus.
Gal 3:27 For as many as were baptized into Christ, you put on Christ.
Gal 3:28 There cannot be Jew nor Greek, there is no slave nor freeman, there is no male and female; for you are all one in Christ Jesus.
Gal 3:29 And if you are of Christ, then you are a seed of Abraham, even heirs according to promise.
Interestingly, the word for color in Hebrew is צבע, which has a similar meaning as טבל, the word for baptism. To dip the finger (especially in blood) to color something.

4 Skin colors – 4 Soil Colors
The four skin tones, pink, yellow, olive and brown, correspond to the 4 colors found in soil. Soil is found in white, red, yellow and brown colors.
Adam, who came from the ground (adamah) was the father of all mankind. Later this was replayed in Noah.
Gen 9:18 And the sons of Noah that went out of the ark were Shem, Ham, and Japheth. And Ham is the father of Canaan.
Gen 9:19 These are the three sons of Noah, and the whole earth was overspread from them.
Gen 9:20 And Noah, a man of the ground (adamah), began and planted a vineyard.
From Shem, Ham and Japheth the world was overspread/scattered into 70 nations (Genesis 10). These 70 nations were divided according to the children of Israel (Deuteronomy 32:8).
Deu 32:8 when the Most High divided to the nations their inheritance; when He separated the sons of Adam, He set up the bounds of the peoples, according to the number of the sons of Israel.
Amazingly, the taxonomy of soil divides the types of dirt into twelve.
Alfisols, Andisols, Aridsols, Entisols, Gelisols, Histosols, Inceptisols, Mollisols, Oxisols, Spodosols, Ultisols, Vertisols.
Israel is a coat of many colors personified by the coat of Joseph.
Gen 37:3 Now Israel loved Joseph more than all his children, because he was the son of his old age: and he made him a coat of many colours.
colours: Kethoneth passim, a coat made of stripes of different coloured cloth.
The Scriptures, as well as tradition speaks of Israel having different shades of skin color.
Genesis Rabah 98:5 says that Simeon and Levi were light colored types
Mishna Negaim 2:1 says that Israelites (in this case Jews of Judah) are mainly of an intermediate type color being neither black (Cushi) or white (Germani)
Genesis Rabah 86:3 says that Joseph was Germani Talmud Sota 36 describes him as having a face like a pink rose
Esau was ruddy/red/blonde Gen 25:25 as was David 1 Samuel 16:2
Laban means white or blonde
The Shepherdess in Song of Solomon was black and comely Son 1:6
Interestingly, color further connects to Israel in the numbers of 7 and 12. There are 7 colors in the color spectrum which corresponds to the 7 branches of the Menorah. The Menorah is a picture of the body of Messiah{Revelation 1:20; John 15:5}. The 7 colors then expand into 12 color hues of the color wheel.
Biblically, race is not defined by color. Race is defined by what nature you are. You are either in Messiah or you are not. You are either for Him or against Him. You are either the seed of the woman or the seed of the serpent. As seen above, the word for color in Hebrew has the same meaning as being baptised and becoming anew. You are either sprinkled by the blood of Messiah (Isaiah 52:15; Hebrew 10:22) or you are still covered in the garments of sinful flesh.
1Pe 2:9 But you are “an elect race,” “a royal priesthood,” “a holy nation,” “a people for possession,” so that “you may openly speak of the virtues” of the One who has called you out of darkness into His marvelous light; LXX-Ex. 23:22; MT-Ex. 19:5, 6
In Hebrew the word for race is גזע, which means the stock/root of a tree.
H1503
גּזע
geza‛
BDB Definition:
1) stem, trunk, stock (of trees)
Who is the root of Israel? Messiah Jesus
Rom 11:16 For if the firstfruit (1Cor 15:52 -Messiah) be holy, the lump is also holy: and if the root (Isa 6:13; Gal 3:16 – Messiah) be holy, so are the branches (Joh 15:5).
Isa 11:1 And there shall come forth a rod out of the stem (H1503 גּזע
geza‛)of Jesse, and a Branch{H5342 נצר netser*} shall grow (parah -bear fruit) out of his roots:
*Netser is the origin of the name ‘Christian’.Netsarim
What is the counterfeit? Zionismclick here
The other root spoken of in Scripture is the root of the serpent
Isa 14:29 Do not rejoice, O Philistia, all of you, for the rod of your striking is broken, because a viper comes forth from the root of a snake, and his fruit shall be a fiery flying serpent.
Notice that from the root of a snake comes for the fruit of a serpent. Above, from the root of Jesse comes forth the fruit of the Spirit. This is the true meaning of race. The seed of the woman or the seed of the serpent. Ye shall know them by their fruits.
The second part of the word ‘chromosome’ comes from the Greek word soma, σῶμα, which means body and is used in various applications (body of man, animals, planets, society, church, etc.). This traces back to multiple Hebrew words which are significant to the current study. In Exodus 24:10 the word body is translated from the Hebrew word ‘etsem’ which is the word for bone coming from the root ‘etz’ meaning a tree. The connection to the Tree of Life is obvious. In Judges 8:30 the Hebrew word ‘yarekh’ is translated as body. Yarekh has the meaning of a shaft as seen in the main trunk of the Menorah in the Temple. This is yet another picture of the Tree of Life and the Messiah.
Here then we see the picture of the chromosome being a gathering of people to form a body. The chromosome is the ‘body’ which holds the DNA which consists of the individual parts which make up the whole. The body of Messiah works the same way. Each individual has a particular purpose to fulfill the whole. This is pictured in the Tabernacle whose individual parts combined to make ONE building (Exodus 36:13). This is seen in the Word which contains many different letters and words to make ONE message.
The Cross
The chromosome is seen in the image of the crossclick here. The cross symbol is a mark of the beast, yet the mark that YHWH places on His faithful believers is in the same shape (Ezekiel 9:4). Herein lies the summation of this entire study. We can be a part of the body of Messiah, who is the Word or we can choose to be a part of the counterfeit body of the beast who is lawlessness. The Tree of Life or the tree of knowledge of good and evil.
Cell
The DNA molecule resides in the nucleus of our cells. Each cells in our bodies is a picture of the Tabernacle/Temple of YHWH with the nucleus representing the Holy Place. The DNA in the nucleus of the cell is pictured by the Torah in/beside the ark of the covenant.
The English word ‘cell’ traces back to the Hebrew word כל ‘kal’ which means to complete. This is also the root of the word ‘kalah’ which means a bride. The cell is a picture of the Tabernacle/Body of Messiah/bride.
The Hebrew word for cell is תא ‘ta’ (Eze 40:7 chamber)
תא Tav aleph is related to the word tav תו (tav=cross…chromosome) and aleph tav את and means a mark/boundary.
תא tav aleph relates to the word tar תר which means the ‘mark of man’ or the border/outline.
From this root we get ta’ar and to’ar. These words mean form, outline or border. This is an important connection to see in that the mark of the beast versus the mark of YHWH ultimately reflects whose image/form you are in.
This connection between the mark and the image/form/outline/shadow picture of YHWH versus the antichrist is further seen in that the word Torah comes from this same root.

We can have the mark of YHWH and be in His image by walking in His Torah and letting Messiah live through us (Galatians 2:20), or we can have the mark of the beast and be in the image of satan by walking in his torah which is lawlessness (Ephesians 2:2-3Isaiah 30:8-11; 1 Peter 2:8).
We can choose the tree of life or the tree of knowledge. The Light of the Word or the false light which is in reality darkness (Matthew 6:23).
Cells, bride & bread…
As seen in ‘Shadows of Messiah – Alphabet’click here the Hebrew Aleph Bet is likened unto manna/bread. Bread is linked to the mark as seen in part 1click here (Exodus 13:9; 1 Corinthians 5:7-Exodus 12:13) and will be discussed in more detail below in the section on gold.
א-ת = Completion
Col 2:9 For in him dwelleth all the fulness of the Godhead bodily.
Col 2:10 And ye are complete in him, which is the head of all principality and power:
“Comprising the first and last letter of the Aleph Beis, את alludes to completion and perfection. Thus the Torah uses the emphatic article in describing the beginning of Creation:

This usage alludes to the fact that the universe was created in complete perfection, ‘from aleph to tav.’ “
Manna = Aleph Tav?
Who is the manna?
Joh 6:30 Then they said to Him, Then what miraculous sign do You do that we may see and may believe You? What do You work?
Joh 6:31 Our fathers ate the manna in the wilderness, as it is written “He gave them bread out of Heaven to eat.” LXX-Psa. 77:24; MT-Psa. 78:24
Joh 6:32 Then Jesus said to them, Truly, truly, I say to you, Moses has not given you the bread out of Heaven, but My Father gives you the true bread out of Heaven.
Joh 6:33 For the bread of God is He coming down out of Heaven and giving life to the world.
Joh 6:34 Then they said to Him, Lord, always give us this bread.
Joh 6:35 Jesus said to them, I am the Bread of life; the one coming to Me will not at all hunger, and the one believing into Me will not thirst, never!
Joh 6:36 But I said to you that you also have seen Me and did not believe.
Joh 6:37 All that the Father gives to Me shall come to Me, and the one coming to Me I will in no way cast out.
Joh 6:38 For I have come down out of Heaven, not that I should do My will, but the will of Him who sent Me.
Joh 6:39 And this is the will of the Father sending Me, that of all that He has given Me, I shall not lose any of it, but shall raise it up in the last day.
Joh 6:40 And this is the will of the One sending Me, that everyone seeing the Son and believing into Him should have everlasting life; and I will raise him up at the last day.
Joh 6:41 Then the Jews murmured about Him, because He said, I am the Bread coming down out of Heaven.
Joh 6:42 And they said, Is this not Jesus the son of Joseph, of whom we know the father and the mother? How does this One now say, I have come down out of Heaven?
Joh 6:43 Then Jesus answered and said to them, Do not murmur with one another.
Joh 6:44 No one is able to come to Me unless the Father who sent Me draws him, and I will raise him up in the last day.
Joh 6:45 It has been written in the Prophets, They “shall” all “be taught of God.” So then everyone who hears and learns from the Father comes to Me; Isa. 54:13
Joh 6:46 not that anyone has seen the Father, except the One being from God, He has seen the Father.
Joh 6:47 Truly, truly, I say to you, The one believing into Me has everlasting life.
Joh 6:48 I am the Bread of life.
Joh 6:49 Your fathers ate the manna in the wilderness and died.
Joh 6:50 This is the Bread coming down out of Heaven, that anyone may eat of it and not die.
Joh 6:51 I am the Living Bread that came down from Heaven. If anyone eats of this Bread, he will live forever. And indeed the bread which I will give is My flesh, which I will give for the life of the world.
Joh 6:52 Then the Jews argued with one another, saying, How can this One give us his flesh to eat?
Joh 6:53 Then Jesus said to them, Truly, truly, I say to you, Except you eat the flesh of the Son of Man, and drink His blood, you do not have life in yourselves.
Joh 6:54 The one partaking of My flesh and drinking of My blood has everlasting life, and I will raise him up at the last day.
Joh 6:55 For My flesh is truly food, and My blood is truly drink.
Joh 6:56 The one partaking of My flesh and drinking of My blood abides in Me, and I in him.
Joh 6:57 Even as the living Father sent Me, and I live through the Father; also the one partaking Me, even that one will live through Me.
Joh 6:58 This is the Bread which came down out of Heaven, not as your fathers ate the manna and died; the one partaking of this Bread will live forever.
Joh 6:59 He said these things teaching in a synagogue in Capernaum.
Joh 6:60 Then many of His disciples having heard, they said, This Word is hard; who is able to hear it?
Joh 6:61 But knowing in Himself that His disciples were murmuring about this, Jesus said to them, Does this offend you?
Joh 6:62 Then what if you see the Son of Man going up where He was at first?
Joh 6:63 It is the Spirit that gives life. The flesh does not profit, nothing! The Words which I speak to you are spirit and are life.
Exo 16:4 And YHWH said to Moses, Behold, I AM! Bread will rain from the heavens for you. And the people shall go out and gather the matter of a day in its day, so that I may test them, whether they will walk in My Law or not.
The matter of a day in its day ‘davar-yom b’yom’
Exo 16:4 ויאמר יהוה אל־משׁה הנני ממטיר לכם לחם מן־השׁמים ויצא העם ולקטו דבר־יום ביומו למען אנסנו הילך בתורתי אם־לא׃
Bread=Torah/Word
Psa 102:4 My heart is stricken and dried like grass, so that I forget to eat my bread.
TARGUM
5. My heart is smitten like grass and will dry up; for I have forgotten the Torah of my instruction.
Deu 8:3 And He has humbled you, and caused you to hunger, and caused you to eat the manna, which you had not known, and your fathers had not known, in order to cause you to know that man shall not live by bread alone, but man shall live by every Word that proceeds from the mouth of YHWH.
Mat 4:2 And having fasted forty days and forty nights, afterwards He hungered.
Mat 4:3 And coming near to Him, the Tempter said, If You are the Son of God, speak that these stones may become loaves.
Mat 4:4 But answering, He said, It has been written: “Man shall not live by bread alone, but on every Word going out of the mouth of God.”
Table of Shewbread
Exo 25:30
Shew-bread – לחם פנים lechem panim literally, bread of faces
His Face (paniym) = Jesus
Psa 42:5 O my soul, why are you cast down and moan within me? Hope in God, for I shall yet thank Him for the salvation (yeshuah) of His presence (paniym).
His Face = His Image
Heb 1:3 who being the shining splendor of His glory, and the express image of His essence, and upholding all things by the Word of His power, having made purification of our sins through Himself, He sat down on the right of the Majesty on high, Psa. 110:1
Psa 17:15 As for me, in righteousness I will look upon Your face; when I awaken, I shall be satisfied by Your image.
The Table

Apostle=shalach from the same root as Table
Apostles take for the Bread of Life to the world
Isa 52:7 How beautiful on the mountains are the feet of him proclaiming good news, making peace heard, bearing tidings of good, making heard salvation, saying to Zion, Your God reigns.
Joh 4:32 But He said to them, I have food to eat which you do not know.
Joh 4:33 Then the disciples said to one another, No one brought Him food to eat?
Joh 4:34 Jesus said to them, My food is that I should do the will of Him who sent Me, and that I may finish His work.
Joh 6:51 I am the Living Bread that came down from Heaven. If anyone eats of this Bread, he will live forever. And indeed the bread which I will give is My flesh, which I will give for the life of the world.
Mat 4:4 But answering, He said, It has been written: “Man shall not live by bread alone, but on every Word going out of the mouth of God.” Deut. 8:3
Mat 6:11 Give us today our daily bread,
Deu 8:3 And He has humbled you, and caused you to hunger, and caused you to eat the manna, which you had not known, and your fathers had not known, in order to cause you to know that man shall not live by bread alone, but man shall live by every Word that proceeds* from the mouth of YHWH.
H4161*
This is related to the Hebrew word for unleavened bread
H4682
matstsâh
BDB Definition:
1) unleavened (bread, cake), without leaven. מצּה
Unleavened Bread is a picture of Messiah. Matsa is pierced, bruised and striped which points back to Isaiah 53, where the Right Arm of YHWH is revealed. The Right Arm of YHWH = the Light of His Face (lechem paniym)
Psa 44:3 For they did not inherit the land with their own sword; yea, their own arm did not save them. But it was Your right hand and Your arm and the light of Your face, because You favored them.
Bread=His Flesh=Gospel

Man was made in the image of God (Genesis1:26)…Messiah is the Image of God (Hebrews 1:3; 2 Corinthians 4:4), hence when we look at the human body it points to Messiah. The body as a whole, and each individual body part speaks the Gospel.
The Gospel is connected w/flesh. Where is the first reference to flesh? The union of Adam and Eve…a picture of Jesus and His Bride becoming one is the fulfillment of the Good News.
Gen 2:21 And YHWH God caused a deep sleep to fall on the man, and he slept. And He took one of his ribs, and closed up the flesh underneath.
Gen 2:22 And YHWH God formed the rib which He had taken from the man into a woman, and brought her to the man.
Gen 2:23 And the man said, This now at last is bone from my bones, and flesh from my flesh. For this shall be called Woman, because this has been taken out of man.
Gen 2:24 Therefore, a man shall leave his father and his mother, and shall cleave to his wife and they shall become one fleshEph 5:30 For we are members of His body, of His flesh, and of His bones.
Eph 5:31 “For this, a man shall leave his father and mother, and shall be joined to his wife, and the two shall be one flesh.” Gen. 2:24
Eph 5:32 The mystery is great, but I speak as to Christ and as to the assembly.
The rib of Adam from whence his bride came out is linked to the number 5 which connects to the 5th day of creation and life.
‘Chamesh’ is used to translate multiple terms in Hebrew. It is used for the number five/fifty, the hand, to be armed and the side of the body (fifth rib).
The ‘fifth rib’
H2570
חמשׁ
chômesh
This word is used in the following verses:
fifth, 4
2Sa_2:23, 2Sa_3:27, 2Sa_4:6, 2Sa_20:10
Messiah was wounded in the side (‘the fifth rib’).
Joh 19:34 But one of the soldiers pierced His side with a lance, and at once blood and water came out.
Adam’s bride came forth from his rib/side (Genesis 2:22) which is a picture of Messiah’s bride ‘coming forth’ when He offered Himself as an atonement to bring us back to God. Interestingly, the year of Jubilee, which occurs every 50 (chamashim) years (Leviticus 25:10-13) began on the Day of Atonementclick here. The great trumpet (Isaiah 27:13) will be blown and those resurrected in the 1st resurrection will receive their inheritance in the land. This is interesting because the shofar is in the Fibonacci sequence which the pattern the Most High uses in His creation of life. The Fibonacci sequence is encoded with the number 5. Even more interesting is that shofars are shaped like a single strand of DNA. If one looks at a shofar and superimposes another one on top of it, the DNA molecule is seen.
Further linking DNA with the shofar is that fact that the shofar is likened unto the voice of Jesus/the Word (Revelation 1:10-11; Isaiah 27:13; John 5:25; 11:43; 1 Thessalonians 4:13).
Our ears are based upon the Fibonacci pattern:


Interestingly, hearing is linked to the mark through the ‘shema’ (Deuteronomy 6:4-9)
The Hebrew word for ears is ‘ozen’ which is linked to the current study as the word for flesh/meat is ‘mazan’ which comes from the same root זנ.

Rom 10:16 But not all obeyed the gospel, for Isaiah says, “Lord, who has believed our report?” Isa. 53:1
Rom 10:17 Then faith is of hearing, and hearing through the Word of God.
Rom 10:18 But I say, Did they not hear? Yes, rather, “into all the earth their voice went out, and to the ends of the world their words.” LXX-Psa. 18:5; MT-Psa. 19:4
Their voice went out. What is the voice of the Word/Jesus likened to? A Shofar (Revelation 1:10-11). Which is in the Fibonacci pattern.
The connection here to sound is significant as more and more research is pointing to the connection between sound and our DNA. This is not surprising as sound and the Word is intimately linked in the Word. All of creation comes forth from the Word/sound (Psalm 33:6). The giving of the 10 commandments and man hearing the voice of God was seen at Mt. Sinai where the shofar blew louder and louder.
Spiritual Science – DNA is influenced by Words and Frequencies
DNA Can Be Influenced And Reprogrammed By Words And Frequencies Russian DNA Discoveries
2005 10 21
Sandpoint , ID — “More than a map of life, DNA processes spirituality according to the latest research. A lengthy review of scientific achievements in the field of genetics compiled by a team of experts indicates that life evolved from spiritual, more than physical, forces.
Three years of multidisciplinary study by a team of health science, mathematics, genetics, and physics experts, indicates that DNA, traditionally considered the “blueprint of life,” appears more like an “antennae to God.” Led by internationally known public health authority and award winning author, Dr. Leonard Horowitz, the group’s research, to be published in October, shows that DNA’s coiled design, vibrating action, and “electrogenetic” function makes spiritual as well as physical evolution possible.
Life’s genomes are empowered by waves and particles of energized sound and light which, more than chemicals or drugs, switch genes “on” or “off.” Likewise, genetic inheritance is energetically transmitted “bioacoustically and electromagnetically” through special water molecules that form the electrogenetic matrix of the “Sacred Spiral.” These hydroelectric geometric structures—most shaped like pyramids, hexagons, and pentagons—direct physical as well as spiritual development, according to researchers.”
It is His Voice/Word that brings Life.
Isa 27:13 And it shall be in that day, the great ram’s horn shall be blown; and those perishing in the land of Assyria and the outcasts in the land of Egypt shall come and shall worship YHWH in the holy mountain in Jerusalem.
Joh 5:25 Truly, truly, I say to you that an hour is coming, and now is, when the dead will hear the voice of the Son of God, and the ones hearing will live.
Joh 5:28 Do not marvel at this, for an hour is coming in which all those in the tombs will hear His voice.
Joh 5:29 And they will come out, the ones having done good into a resurrection of life; and the ones having practiced evil into a resurrection of judgment.
Joh 11:43 And saying these things, He cried out with a loud voice, Lazarus! Here! Outside!
1Th 4:16 Because the Lord Himself shall come down from Heaven with a commanding shout of an archangel’s voice, and with God’s trumpet. And the dead in Christ will rise again first.
Mat 24:31 And He will send His angels with a great sound of a trumpet, and they will gather His elect from the four winds, from the ends of the heavens to their ends.
1Co 15:52 In a moment, in a glance of an eye, at the last trumpet; for a trumpet will sound, and the dead will be raised incorruptible, and we shall all be changed.
The Voice of Jesus brings back the exiles. This is significant as it will be seen that the message of the Gospel given to the Apostles is likened to bread from the Table of showbread, as they are made ‘fishers’ of men.
Joh 10:3 The doorkeeper opens to him, and the sheep hear his voice, and he calls his own sheep by name, and leads them out.
Joh 10:16 And I have other sheep which are not of this fold. I must also lead those, and they will hear My voice; and there will be one flock, one Shepherd.
Joh 10:27 My sheep hear My voice, and I know them, and they follow Me.
Joh 10:28 And I give eternal life to them, and they shall not perish to the age, never! And not anyone shall pluck them out of My hand.
Jer 31:6 For there shall be a day when the watchmen on Ephraim’s hills shall call out, Arise and let us go up to Zion, to YHWH our God.
Jer 31:7 For so says YHWH, Sing with gladness for Jacob, and shout among the head of the nations. Cry out, give praise and say, O YHWH save Your people, the remnant of Israel.
Jer 31:8 Behold! I will bring them from the north country, and gather them from the recesses of the earth. Among them the blind, and the lame, the pregnant one, and the travailing one together, a great company shall return here.
Jer 31:9 They shall come with weeping, and I will lead them with prayers. I will cause them to walk by rivers of waters, in a right way; they will not stumble in it. For I am a father to Israel, and Ephraim is My first-born.
Jer 31:10 Hear the Word of YHWH, O nations, and declare in the coastlands far away, and say, He who scattered Israel will gather him and keep him, as a shepherd his flock.
Bread of His presence, the Showbread
Jesus is His paniym (presence, face)
Psa 42:5 O my soul, why are you cast down and moan within me? Hope in God, for I shall yet thank Him for the salvation of His presence.

Psa 44:3 For they did not inherit the land with their own sword; yea, their own arm did not save them. But it was Your right hand (Messiah- Exo 15) and Your arm (Messiah Isa 53) and the light of Your face, because You favored them.
Interestingly the arm and hand are in the Fibonacci pattern.
The Light of His Face is linked with the sound of the Shofar
Psa 89:15 Blessed is the people knowing the joyful sound; O YHWH, they shall walk in the light of Your face.
What is the joyful sound? The sound of the Shofar & Trumpets.
Psa 98:5 Sing praise to YHWH with the lyre; with the lyre and the voice of a song.
Psa 98:6 With trumpets and the sound of a horn, make a joyful noise before YHWH the King.
The sound of the trumpets = the sound of His Word.
Num 10:2 Make two trumpets of silver for yourself. You shall make them of hammered work, and they shall be to you for the calling of the congregation, and for causing the camps to pull up stakes.
Psa 12:6 The Words of YHWH are pure Words, like silver refined in an earthen furnace, purified seven times.
The bread of the Presence sat upon a table. The Hebrew word for table is Shulchan coming from the root shalach meaning to send out, as in one sending out his hand to the table to receive food (life). This is the concept of an Apostle (sholiach), one who sends forth a message of good news (basar – meat/gospel).
The first use of the word ‘shalach’ is seen in Genesis 3:23 where Adam was expelled from the Garden due to the sin of eating from the tree of knowledge.
Gen 3:23 YHWH God sent him out of the garden of Eden to till the ground out of which he was taken.
Adam was to work the ground from whence he was taken. Adam, who partook of the tree of knowledge which brings death, sent forth ‘shalach’ his message to the world (1 Corinthians 15:22). The bread that comes forth from the earth brings temporal life but cannot deliver from death. The message of Messiah comes forth from the Tree of Life. It is the bread from heaven that brings life to the world.
Apostles take for the Bread of Life to the world
Isa 52:7 How beautiful on the mountains are the feet* of him proclaiming good news, making peace heard, bearing tidings of good (basar), making heard salvation (Heb. yeshua), saying to Zion, Your God reigns.
*The feet are in the pattern of the Fibonacci sequence.
Joh 4:32 But He said to them, I have food to eat which you do not know.
Joh 4:33 Then the disciples said to one another, No one brought Him food to eat?
Joh 4:34 Jesus said to them, My food is that I should do the will of Him who sent Me, and that I may finish His work.
Joh 6:51 I am the Living Bread that came down from Heaven. If anyone eats of this Bread, he will live forever. And indeed the bread which I will give is My flesh, which I will give for the life of the world.
Going back to the connection between the gospel (basar) and Adam & Eve…
The word for bride is:

This comes from the root ‘kol’ which is related to the belly (chay-life):

The Hebrew word for food comes from this same root:

The English word cell comes from this Hebrew root. The human cell is designed just as the Tabernacle/Temple. DNA, in the nucleus of the cell is the blueprint for life & the flesh. It corresponds to the 10 commandments and the Torah in the Holy of Holies of the Tabernacle. DNA is formed in the Fibonacci pattern.

Cell -early 12c., “small room,” from L. cella “small room, store room, hut,” related to L. celare “to hide, conceal,” from PIE base *kel- “conceal”
The word cell traces back to the Latin ‘cella’ and then to the Hebrew word ‘kol’ כל. Kaf is the 11th letter of the Hebrew alphabet and Lamed is the 12th. Combined this makes 23, corresponding to the 23 chromosomes in the human body where the DNA is stored.
http://www.icr.org/article/shapes-numbers-patterns-divine-proportion-gods-cre/
When we realize that the information to produce these spirals and numbers in living things is stored in the DNA, should we then be surprised to find that the DNA molecule is 21 angstroms in width and the length of one full turn in its spiral is 34 angstroms, both Fibonacci numbers? The DNA molecule is literally one long stack of golden rectangles.
The DNA spiral is a Golden Section
The DNA molecule, the program for all life, is based on the golden section. It measures 34 angstroms long by 21 angstroms wide for each full cycle of its double helix spiral.
34 and 21, of course, are numbers in the Fibonacci series and their ratio, 1.6190476 closely approximates phi, 1.6180339.
B-DNA has spirals in phi proportions
DNA in the cell appears as a double-stranded helix referred to as B-DNA.
This form of DNA has a two groove in its spirals, with a ratio of phi in the proportion of the major groove to the minor groove, or roughly 21 angstroms to 13 angstroms.

The Hebrew word for Temple (Heykal) comes from the same root as cell, food and bride (kol).

This corresponds perfectly to the Temple/Tabernacle of God and the word cell means hidden.
Eze 7:22 I also will turn My face from them, and they shall defile My hidden place. And violent ones shall enter into it and defile it.
Our bodies are His Temple (Ephesians 2:21-22; 5:30; 1 Corinthians 6:19) which are intimately linked to the Fibonacci sequence & the number 5 (the 5th dayclick here).
666 – Poison Book
Col 2:8 Watch that there not be one robbing you through philosophy and empty deceit, according to the tradition of men, according to the elements of the world, and not according to Christ.
Paul warns believers not to be deceived by the elements of the world. The word for element is ‘stoicheion’ in the Greek which can be translated as the letters of the alphabet. Being robbed by vain philosophy is what happened to Adam and Eve in the Garden. This is further connected through verse 4.
Col 2:4 And I say this that no one may beguile you with persuasive words.
Paul further links this portion of Scripture with the worship of angels. Paul admonishes believers to hold fast to Messiah and stay in His body. We must not allow ourselves to be beguiled into joining the fallen angels.
Col 2:18 Let no one condemn you, delighting in humility (lowliness of mind) and worship of the angels, pushing into things which he has not seen, being puffed up by the mind of his flesh without cause,
Col 2:19 and not holding fast the Head, from whom all the body having been supplied through the joints and bands, and being joined together, will grow with the growth of God.
Col 2:20 If, then, you died with Christ from the elements of the world, why are you under its decrees, as living in the world?
χξς (666) in Hebrew would be rendered:

The ם mem sofit is only at the end of Hebrew words so the only word which could be translated correctly is וסם (v’sam) starting at the left and going right. This makes sense as Greek is written from left to right and Hebrew is written from right to left.
סםsamek mem sofit is translated into Hebrew as drug/poison…the vav in the front would be rendered ‘and’ or ‘adding’. Adding poison. The Hebrew word for number is mispar which is from the same root as the word for book sepher.


The number 666 then may be alluding, on a deeper level, to a poison book that is added to the Book of Life (Deuteronomy 12:32; Revelation 22:18-19). The Quran…The Talmud (Oral law)…The Gnostic Gospels…The Catholic Catechism… On a physical level what is the book of life? DNA. Adding poison to the book of life = adding ‘poison’ to DNA.
This word samek mem sofit is not used in Scripture.

However, looking at the word sum which comes from this root draws some interesting connections to 666.

Notice that this word is translated into English as name and mark. Also notice that the word ‘shem’ שם is related to this word as it is a ‘df’ defective spelling. Shem is the word typically translated as name. It means the character, the breath of a thing.
Poison waters
The adversary counterfeits the Most High
Isa 14:14 I will rise over the heights of the clouds; I will be compared* to the Most High.
*The adversary wants to appear just like the Messiah. This is a key to understanding what the mark of the beast is and who the antichrist is. The word used by Yeshayahu is damah meaning the resemblance of a son to his father which is passed down through blood (DNA).

The word for blood is דם which combines the letter mem which means water and dalet which means a door.
The waters from the door is depicted in the Word as the Living Waters that come forth from the Throne of God. Amazingly, the human heart is a shadow picture of that throne.
The Fountain of Life
Jer 17:13 O LORD, the hope {H4723 mikveh=collection of water/pool…baptism} of Israel, all that forsake thee shall be ashamed, and they that depart from me shall be written in the earth (John 8), because they have forsaken the LORD, the fountain of living waters.
Psa 36:7 How excellent is thy lovingkindness, O God! therefore the children of men put their trust under the shadow of thy wings.
Psa 36:8 They shall be abundantly satisfied with the fatness of thy house; and thou shalt make them drink of the river of thy pleasures. {H5730 עדן‛eden}
Psa 36:9 For with thee is the fountain of life: in thy light shall we see light.
Who abides in His shadow? Zion
Psa 36:7 How precious is Your mercy, O God! And the sons of men take refuge in the shadow of Your wings.
Isa 51:16 And I have put My Words in your mouth, and covered you in the shade of My hand, to plant the heavens and found the earth, and to say to Zion, You are My people.
Psa 36:8 They shall be satisfied (watered) from the abundance of Your house; and You make them drink the torrent of Your pleasures.
Pleasures=Eden
Rev 21:6 And He said to me, It is done! I am the Alpha and the Omega, the Beginning and the Ending. To the one thirsting, I will freely give of the fountain of the Water of Life.
Rev 22:17 And the Spirit and the bride say, Come! And the one hearing, let him say, Come! And the one thirsting, let him come; and the one desiring, let him take of the water of life freely.
Isa 51:3 For YHWH comforts Zion. He comforts all her desolations, and He makes her wilderness like Eden, and her desert like the garden of YHWH; joy and gladness shall be found in it, thanksgiving and the voice of singing praise.
Psa 36:9 For with You is the fountain (H4726 מקר maqor)of life; in Your light we see light.
‘maqor’ comes from the root כר ‘kar’ which is translated in the Septuagint as ‘charax.’ ‘Charax’ is the root of ‘charagma’ the word for mark in Revelation 13.

Gal 3:27 For as many of you as have been baptized into Christ have put on Christ.
Isa 61:10 I will greatly rejoice in the LORD, my soul shall be joyful in my God; for he hath clothed me with the garments of salvation he hath covered me with the robe of righteousness, as a bridegroom decketh himself with ornaments, and as a bride adorneth herself with her jewels.
The corruption of the Living Waters is seen in Scripture as wormwood which is poison.
Wormwood
Rev 8:11 And the name of the star is said to be Wormwood. And the third part of the waters became changed into wormwood. And many men died from the waters, because they were bitter.
Wormwood=bitterness, hemlock, poison
H3939
לענה
la‛ăna^h
BDB Definition:
1) wormwood
1a) bitterness (metaphorically)
Part of Speech: noun feminine
A Related Word by BDB/Strong’s Number: from an unused root supposed to mean to curse
Wormwood may be related to the planet Nibiru and the return of the fallen angelsclick here. Numerous events in Revelation, in specific those described in chapters 8 & 9 are synonymous with what is described by ancient Sumerian writings in reference to Nibiru/Planet X. The most significant of these events is the coming of the Annunaki/fallen angels who ‘create/recreate’ man in their image.
לענה – la’anah wormwood
לענה comes from לע which means a throat, from whence the word comes.
Idolatry, corruption of His Image, leads to wormwood.
Deu 29:17 And you have seen their detestable things, and their idols of wood and stone, silver and gold, which were among them;
Deu 29:18 that there not be among you man, or woman, or family, or tribe, whose heart turns away today from YHWH our God, to go and serve the gods of these nations; lest there should be among you today a root that bears gall and wormwood;
Bitter water is also linked to rebellion and murmuring which was seen by Israel in the wilderness.
Rebellion in Hebrew is represented by stagnant waters.
The Word of YHWH is likened unto Living Waters (Jeremiah 2:13; 17:13; Isaiah 12:2-3; John 4:10-14; 7:37-39), it is no surprise that rebellion is represented by stagnant waters which don’t move and bring forth death when drunk.
Rebellion is synonymous with disobedience/lawlessness (Deuterononomy 1:26, 43; 9:23; Psalm 107:11; Isaiah 30:9*).
*More on this below
Eze 12:2 Son of man, you dwell in the midst of a rebellious house. They have eyes to see, but they do not see; they have ears to hear, but they do not hear; for they are a rebellious house.
Notice that the rebellious house of Israel is likened to those who have eyes to see but can’t see…this is also spoken of by the prophet Isaiah in chapter 6 where he speaks of when He saw Jesus in His Glory.
Isa 6:1 In the year that King Uzziah died, then I saw the Lord sitting on a throne, high and lifted up. And His train filled the temple.
Isa 6:2 Above it stood the seraphs. Each one had six wings; with two he covered his face; and with two he covered his feet; and with two he flew.
Isa 6:3 And one cried to the other and said, Holy, holy, holy is YHWH of Hosts; all the earth is full of His glory!
Isa 6:4 And the doorposts shook from the voice of the one who cried; and the house was filled with smoke.
Isa 6:5 Then I said, Woe is me! For I am cut off; for I am a man of unclean lips, and I live amongst a people of unclean lips; for my eyes have seen the King, YHWH of Hosts.
Isa 6:6 Then one of the seraphs flew to me with a live coal in his hand, snatched with tongs from the altar.
Isa 6:7 And he touched it on my mouth, and said, See, this has touched your lips; and your iniquity is taken away, and your sin is covered. (Notice the link to the mouth. Wormwood comes from the root ‘la’ which means the throat.)
Isa 6:8 And I heard the voice of YHWH, saying, Whom shall I send, and who will go for Us? Then I said, Behold me. Send me!
Isa 6:9 And He said, Go and say to this people, Hearing you hear, but do not understand; and seeing you see, but do not know.
Isa 6:10 Make the heart of this people fat, and make his ears heavy, and shut his eyes, that he not see with his eyes, and hear with his ears, and understand with his heart, and turn back, and one heals him. (Ezekiel 12:2 defines this as rebellion)
Isa 6:11 Then I said, Until when, O Lord? And He said, Until cities lie desolate without one living in them, and the houses without man, and the land is laid waste, a desolation;
Isa 6:12 and until YHWH has sent mankind far away, and the desolation in the midst of the land is great.
Isa 6:13 But yet a tenth shall be in it, and it shall return and be consumed like the terebinth and like the oak that in being felled yet has its stump (the holy seed is its stump).
Verse 13 is speaking of the tree of Life, the Olive tree of Israel who is Messiah Jesus. This is shown in more detail in the section on ‘Jacob’s ladder.’
This portion of Scripture is what got Isaiah killed according to ancient tradition where he was said to have been ‘sawn asunder’ (Hebrews 11:37). This came because Isaiah spoke of Jesus as YHWHclick here (John 12:32-41) which did not fit into the theology of the religious leaders of the day who had eyes but couldn’t see and ears but couldn’t hear (Matthew 13:14; Mark 4:12; Acts 28:26; Romans 11:8). So too in the end this is what is said to occur (Matthew 10:22; 24:9; Mark 13:13; John 15:21). This is what led to the stoning of Stephen in Acts 7:55 where Stephen saw Jesus in Glory. The Jews also tried to stone Jesus for the same reason.
Joh 10:30 I and the Father are One!
Joh 10:31 Then again the Jews took up stones, that they might stone Him.
Interestingly, in the wilderness Moses was almost stoned because of a lack of water (Exodus 17:3). It is here where water came forth from the Rock, who Paul describes as the Messiah (1 Corinthians 10:4). The people murmured against Moses. The word in Hebrew is ‘lun’ which means to lodge, or to stay in one place. The people became ‘stagnant waters’, they became rebellious. This rebellion leads to wormwood.
Jer 9:13 And YHWH says, Because they have forsaken My Law which I set before them, and have not obeyed My voice, and have not walked in it;
Jer 9:14 but have walked after the stubbornness of their own heart, and after the Baals, which their fathers taught them;
Jer 9:15 so YHWH of Hosts, the God of Israel, says this: Behold, I will feed them, this people with wormwood, and make them drink poison waters.
The hexagram is linked to the Hebrew alphabet
Going back to the word 666 in Hebrew וסם and its relation to שם it is seen that the hexagram is linked to 666. The hexagram is linked in numerous other ways to 666 as wellclick here.
The Hebrew letter shin is related to ‘fire’ in ancient thought. The Hebrew letter Mem is a pictograph of water. Water & fire.
![]()

Notice what image is formed by combining fire and water in occultic thought. The Hexagram. Also notice that it is the combination of air (heaven) and earth. וסם means to add poison or שם the name of the beast…his character. The mixture of heaven and earth. As above so below…beast & man.
‘Junk DNA’
There are approximately 3 billion letters in the human genome, only 1% code for protein (DNA Interactive-www.dnai.org). Most of the DNA molecule is referred to as ‘junk DNA’ that is supposedly an unneeded remnant from our evolutionary past. This, of course, is 100% fallacious.
Even though ‘junk DNA’ doesn’t make proteins, it still functions in the same manner as the 1% that does. The ‘junk DNA’ is known as ‘introns.’ Introns are called non-coding DNA because they are not used to form proteins. However, they still work in the same way as language even forming palindromes and maintaining the symmetry between complementary strands. Using the Zipf law, scientists have found that non-coding DNA is similar to human languages.
Zipf Law
Language in junk DNA – Karl Kruszelnicki
http://www.abc.net.au/science/articles/2001/04/04/133634.htm?site=science/greatmomentsinscience
“According to the linguists, all human languages obey Zipf’s Law. It’s a really weird law, but it’s not that hard to understand. Start off by getting a big fat book. Then, count the number of times each word appears in that book. You might find that the number one most popular word is “the” (which appears 2,000 times), followed by the second most popular word “a” (which appears 1,800 times), and so on. Right down at the bottom of the list, you have the least popular word, which might be “elephant”, and which appears just once.
Set up two columns of numbers. One column is the order of popularity of the words, running from “1” for “the”, and “2” for “a”, right down “1,000” for “elephant”. The other column counts how many times each word appeared, starting off with 2,000 appearances of “the”, then 1,800 appearances of “a”, down to one appearance of “elephant”.
If you then plot on the right kind of graph paper, the order of popularity of the words, against the number of times each word appears you get a straight line! Even more amazingly, this straight line appears for every human language – whether it’s English or Egyptian, Eskimo or Chinese! Now the DNA is just one continuous ladder of squillions of rungs, and is not neatly broken up into individual words (like a book).
So the scientists looked at a very long bit of DNA, and made artificial words by breaking up the DNA into “words” each 3 rungs long. And then they tried it again for “words” 4 rungs long, 5 rungs long, and so on up to 8 rungs long. They then analysed all these words, and to their surprise, they got the same sort of Zipf Law/straight-line-graph for the human DNA (which is mostly introns), as they did for the human languages!
There seems to be some sort of language buried in the so-called junk DNA!”
Dr. Len Horowitz has found that the primary function of DNA may not be the formation of proteins but as a ‘spiritual antennae’ to the Creator.
Spiritual Science – DNA is influenced by Words and Frequencies:
DNA Can Be Influenced And Reprogrammed By Words And Frequencies Russian DNA Discoveries
“More than a map of life, DNA processes spirituality according to the latest research. A lengthy review of scientific achievements in the field of genetics compiled by a team of experts indicates that life evolved from spiritual, more than physical, forces.
Three years of multidisciplinary study by a team of health science, mathematics, genetics, and physics experts, indicates that DNA, traditionally considered the “blueprint of life,” appears more like an “antennae to God.” Led by internationally known public health authority and award winning author, Dr. Leonard Horowitz, the group’s research, to be published in October, shows that DNA’s coiled design, vibrating action, and “electrogenetic” function makes spiritual as well as physical evolution possible.
Life’s genomes are empowered by waves and particles of energized sound and light which, more than chemicals or drugs, switch genes “on” or “off.” Likewise, genetic inheritance is energetically transmitted “bioacoustically and electromagnetically” through special water molecules that form the electrogenetic matrix of the “Sacred Spiral.” These hydroelectric geometric structures—most shaped like pyramids, hexagons, and pentagons—direct physical as well as spiritual development, according to researchers.”
The Menorah is linked to the Solfeggio scale through a spiraling movement, also linking it to the DNA helix:
The Menorah and the Solfeggio Scale

Identity – You are the Tabernacle of God by John Saba pg 54
Day 1 of creation corresponds to day 4. Day 2 corresponds to day 5. Day 3 corresponds to day 6. The Light of the 1st day connects with the light of the sun on day 4. The fish in the 5th day and the water of the 2nd day connect. Man in the 6th day connects with the earth/dust from whence he came. Using this pattern Mr. Saba found that the menorah shows the original Solfeggio scale Solfeggio Scale .
Left to right
174, 285, 396
Right to left
417, 528, 639
Bottom to right to left
741, 852, 963
1: Ut=396=9
2. Re=417=3
3. Mi=528=6
4. Fa=639=9
5. Sol=741=3
6. La=852=6
By following the above, 174, 285, 396 etc, a spiral movement is seen. Here we see a connection, via the Menorah, between light and sound. The 7 branches of the Menorah correspond to the 7 notes in the musical scale and the 7 colors in the color spectrum and the 7 wavelengths of the electromagnetic spectrum.
As seen in Shadows of Messiah – Mathematicsclick here, all of creation is based upon frequencies which are numbers. Marko Rodin discovered what has come to be known as vortex based mathematics which is based upon the same 3, 6, 9 pattern of the Solfeggio scale. The significant part of Rodin’s discoveries is that DNA fits into this same pattern.
Digging deeper, Stan Tenen (meru.org) has found even more connections between Vortex based mathematics and DNA.
http://www.valdostamuseum.org/hamsmith/Torah.html
“The 3,10 knot is defined by a braided column of 99 tetrahedra. [Each column of 99 tetrahedra represents 3 turns in the knot]. Each of the 3 turns in the knot is represented by a column segment of 33 tetrahedra. Each segment of 33 tetrahedra has 4×33 = 132 faces, of which 132/2 = 66 are internal and 132/2 =66 are external. The 66 external faces form 3 strings of 22 faces each, and each string corresponds to the 22 Hebrew letters.
66 of course, corresponds to the number of books in the Bible.
As seen in part 5click here, the Menorah is a picture of the Word.
The 66 books of the Bible are spiraled into 3 cycles, encompassed by the 22 Hebrew letters, which then beautifully manifests the 7 divisions of the Biblical Canon

The Bible Wheel is a circular presentation of the Bible that I discovered by rolling up the traditional list of the sixty-six books like a scroll on a spindle wheel of twenty-two spokes, corresponding to the twenty-two letters of the Hebrew alphabet. The order of the Hebrew alphabet is established in the alphabetically structured passages of the Old Testament, most notably Psalm 119 that praises God’s Word from Aleph to Tav, from beginning to end. This exemplifies how everything in the Bible Wheel is derived from Scripture and Scripture alone.

This division of the Scriptures into portions of 7 can is portrayed in the Menorah.
http://www.biblewheel.com/Topics/Menorah.asp

528
John Saba
“For those of you who study the DNA , which is really Jacob’s Ladder, research scientists are now using sound to heal damaged chromosomes.
The frequency used is 528 . WHICH IS THE CENTRAL FREQUENCY OF THIS LIST OF NINE FREQUENCIES.”
The Number 528 – the Key – Richard McGough
http://www.biblewheel.com/gr/gr_528.asp
This Key is literally the Key to the Bible. It appears here in the 22nd verse of the 22nd chapter of the all-inclusive Book of Isaiah, and is itself a multiple of the Number 22! In fact, it is the product of the number of letters in the Hebrew (22) and Greek (24) alphabets:
The KEY is subsumed in the same numerical category as the Alphabet itself:
Note also that the Key opens the 66 Books of the Galgal (Wheel = 66) and so is itself a multiple of 66:
Interestingly, The full value of the Name of Messiah is also 528
The Full Value of a word is calculated by replacing each letter of the word with its name, and summing the result.
DNA Spirit – Martina Hoffman
http://www.redicecreations.com/specialreports/2005/10oct/spiritualscience.html
“The human DNA is a biological Internet and superior in many aspects to the artificial one. The latest Russian scientific research directly or indirectly explains phenomena such as clairvoyance, intuition, spontaneous and remote acts of healing, self healing, affirmation techniques, unusual light/auras around people (namely spiritual masters), the mind’s influence on weather patterns and much more.”
“Esoteric and spiritual teachers have known for ages that our body is programmable by language, words and thought. This has now been scientifically proven and explained. Of course the frequency has to be correct. And this is why not everybody is equally successful or can do it with always the same strength. The individual person must work on the inner processes and maturity in order to establish a conscious communication with the DNA. The Russian researchers work on a method that is not dependent on these factors but will ALWAYS work, provided one uses the correct frequency.
But the higher developed an individual’s consciousness is, the less need is there for any type of device! One can achieve these results by oneself, and science will finally stop laughing at such ideas and will confirm and explain the results. And it doesn’t end there. The Russian scientists also found out that our DNA can cause disturbing patterns in the vacuum, thus producing magnetized wormholes! Wormholes are the microscopic equivalents of the so-called Einstein-Rosen bridges in the vicinity of black holes (left by burned-out stars).
These are tunnel connections between entirely different areas in the universe through which information can be transmitted outside of space and time. The DNA attracts these bits of information and passes them on to our consciousness. This process of hypercommunication is most effective in a state of relaxation. Stress, worries or a hyperactive intellect prevent successful hypercommunication or the information will be totally distorted and useless. In nature, hypercommunication has been successfully applied for millions of years. The organized flow of life in insect states proves this dramatically. Modern man knows it only on a much more subtle level as “intuition”. But we, too, can regain full use of it.
An example from Nature: When a queen ant is spatially separated from her colony, building still continues fervently and according to plan. If the queen is killed, however, all work in the colony stops. No ant knows what to do. Apparently the queen sends the “building plans” also from far away via the group consciousness of her subjects. She can be as far away as she wants, as long as she is alive. In man hypercommunication is most often encountered when one suddenly gains access to information that is outside one’s knowledge base.”
“Now that we are fairly stable in our individual consciousness, we can create a new form of group consciousness, namely one, in which we attain access to all information via our DNA without being forced or remotely controlled about what to do with that information. We now know that just as on the internet our DNA can feed its proper data into the network, can call up data from the network and can establish contact with other participants in the network.
Remote healing, telepathy or “remote sensing” about the state of relatives etc. can thus be explained. Some animals know also from afar when their owners plan to return home. That can be freshly interpreted and explained via the concepts of group consciousness and hypercommunication. Any collective consciousness cannot be sensibly used over any period of time without a distinctive individuality. Otherwise we would revert to a primitive herd instinct that is easily manipulated.
Hypercommunication in the new millennium means something quite different: Researchers think that if humans with full individuality would regain group consciousness, they would have a god-like power to create, alter and shape things on Earth! AND humanity is collectively moving toward such a group consciousness of the new kind.”
DNA Activation
The term DNA activation is used heavily amongst those who believe that man is evolving into godhood. Part of the reasoning behind this is that the junk DNA is in reality the ‘god-part’ which needs to be activated.
DNA Merkaba Activation
http://www.oakrose.net/dna-merkaba-activation.html
“We all have about 97 percent dormant DNA within our original eight-cell blueprint. Traditionally science has referred to this dormant DNA as “junk DNA”, but actually it isn’t junk at all, but rather dormant encodings of Light that are awaiting activation at the highest levels of spiritual awareness. These 12-strand DNA codes and their corresponding chromosome pairs are potential gateways to higher consciousness, enhanced biophysical abilities, and re-unification with our highest spiritual self. These gateways, (also known as wormholes), that are built right into our original eight-cell blueprint can be activated through meditation, higher planes of consciousness, and the intention to re-activate and actualize their full potential.”
This terminology of DNA activation is being used amongst Christians as well.
http://www.deceptionbytes.com/content/new-apostolic-reformation-adam-kadmon-and-dna
The New Apostolic Reformation, Adam-Kadmon, and DNA
“Below is a quote from John Lewis from Age to Age Ministries in which explains the use of this term DNA. Interestingly enough, Age to Age ministries, which I had never heard of prior to my research, claims to be a Christian ministry.
The 97% of your DNA that’s not activated is GOD waiting to be activated in man. You have the information and intelligence of Adam the son of God encoded in your DNA. Access and activation to this information will cause you to live as Adam the God-man in the Garden of your Be-in.
When Divine Nature is completely activated within man, he will be able to naturally transport himself from place to place without the aid of modern transportation. Elijah and Philip in the Bible were only examples of what will become the norm.
As the 97% of unused DNA is activated the 2-Strand double helix becomes a 12 –Strand DNA. Since science doesn’t understand the 97%, they don’t understand the purpose for the 5 extra pairs of DNA strands (shadow strands).
The 12-Strand DNA represents man coming into his Divineness. Mankind created in the image and likeness of God can be nothing less that God. Every seed must bring forth after its kind. Man is the visible expression of the invisible God. This has been the Creators plan from the beginning to multiply Himself to the point of filling All things.
Organized religion spends time shouting and screaming at their followers convincing them that they are not Gods. It seems to be their mission to deceive their followers into believing they are only human that can not think for themselves. The powers that be realize that if their followers would begin to activate the Divine Nature that would be the end of Organized Religion as we see it today.” http://www.atam.org/DNA.html”
“We participated in a leadership meeting on Monday prior to the conference where Dutch released the vision of the Apostolic Alliance. It was a powerful three days of God imparting His DNA into this apostolic movement for national transformation.” April 2008 e-newsletter by Prayer Focus Ministries describing the Apostolic Alliance gathering in Colorado Springs, Colorado
God is trying to get us to a place of really understanding who we are. The church is having an identity crisis. When the people of God begin to realize that the purpose of Jesus on the earth was to birth a new breed of people who would carry the DNA of God within them and bring heaven to earth daily, we will begin to live with purpose. When the people of God begin to realize their identity as the very offspring of God and that as He is right now, so are we in this world, the church will begin to shake the nations with the power of God.” [“The New Breed – Part 2,” Ryan Wyatt, Abiding Glory Ministries, Open Heaven]
Insight is the God given ability for you to know your Identity, your Kingdom ID; your spiritual DNA; your uniqueness in the earth and in the Body of Christ. There is no one like you. You are predestined for Greatness. Chuck Pierce School of the Spirit, Faith Summit Church, Monday, March 24, 2008
The Living Word or Bread of life once again desires to be made flesh through a body of people joined with Him in a holy consummation. As we live not by natural bread alone, but by the living Word proceeding from the mouth of God, the bread of abundant life, even so the hidden truth of godliness will become part of our spiritual DNA.”
[“Shepherd’s Rod, Part 1: Blood and Fire,” Paul Keith Davis and Bob Jones: Oct 11, 2004]
I have called the best of every blood line in earth unto this generation…I have elected to bring them forth in this generation…the Elect Generation…even the bloodline of Paul…of David…of Peter, James and John…They will even be superior to them in heart, stature and love for me’…Your children will possess the spirit without measure…They will move into things of the supernatural that no one has ever moved in before…coming into the Divine Nature of Jesus Christ…a Church that has reached the full maturity of the God-Man! This generation…is going to see the beginning of this World-wide New Order.” Vineyard Prophecy Conference, 1989″
Adam Kadmon & DNA Activation
The Adam Kadmon
http://www.treeoflighthc.com/workshops_adamkadmon.htm
“From the beginning of time, Prophecies and Myths have spoken of Humankind evolving into a “God Like” being. The Kaballah has called this being of prophecy the Adam Kadmon – which means literally, “God Human”. The Mystery Schools have spoken of the Great Work – defined as reuniting the Body and Soul with the Spirit. Which is the transformation of the self, into the highest potential being – striving to reach this exalted state.”
“This is why we call this program The Adam Kadmon. The Adam Kadmon Workshops are about living in a new way, in order to become a different kind of Human. The teachings are simple, they are followed by a 24 Strand DNA Activation” which is designed to create that “return to the Divine State”.
Divine Law is: As Above – So Below. The Mystery teachings are: Everything, which exists in the physical, must first be created in the Spirit. Everything physical has its counterpart in Spirit. If there are 12 strands of physical DNA, there are 12 Spiritual DNA strands. DNA Activation must include both the Spiritual as well as the physical.
All Mystery School traditions have a Ritual and Activation Process which results in activation of 11 of 12 strands (which we call “Codons”) of the Physical and Spiritual D.N.A. The two Codons which are not activated by this method are called the Galactic Code (physical DNA), and the Divinity Code (Spiritual DNA). All mystery school traditions have taught that when humankind is ready, a technique would be given to activate the last two Codons. The Activation of these Codons would result in the manifestation of the Adam Kadmon, that God-Like Human.
This is work that King Salomon began, nearly 3000 years ago. Finally, we may finish this! We may complete the cycle and become the perfected human – transforming from Humankind to Humanity. This is the most glorious time to live in!”
Serpent in the Tree
Throughout history, the image of the serpent in the tree has been passed down in various forms throughout the Mysteries. Ultimately, this image is pointing to the double helix structure of DNA. It is through the serpent and the tree of knowledge that death entered into the DNA of man. The doctrine of the Mysteries is that the serpent brought godhood to mankind but in reality brought sin and death.
In the English translation of Genesis 3, the serpent spoke 46 words to Eve, corresponding the 46 chromosomes in the human body. In Hebrew, the words of the serpent add up to 26, the number for YHWH.
The serpent in a tree and its link to DNA is found throughout all cultures.
According to Tony Bushby, the ancient Egyptians knew of the serpent-DNA connection and its link to the Word.
“For thousands of years, spiritual teachers of Jewish traditions claimed that the five major Hebrew texts making up the Torah were ‘holy’, of special significance, and of supernatural origin…and they were right. By producing an exact copy of the spiral shape of the Rainbow Serpent from plastic, brass, a strip of metal or a similar solid substance, its significance becomes apparent, and that item could be best described as ‘light descended into matter’. It is the primary element of both the Book of Thoth and the Secret in the Bible and the precise twisty shape of the Rainbow Serpent provides the necessary form to physically demonstrate a major part of the Secret. When the plastic or metal reproduction of the Rainbow Serpent is slowly revolved, 22 different shaped shadows are cast from that one element, and those shapes directly make up the 22 seperate letters of the alphabet that the Torah was written in. Put in simplest terms, the alphabetin which the Torah of the Bible was originally and secretly written was one composed of a series of 22 cosmic glyphs that emanated with ‘splendour and power in the form of a serpent’ from a vertical spiral of light in the Benben on top of the Great Pyramid in Egypt. Evidence of that knowledge points directly at the undeniable input of a higher intelligence, a superior mind source.” (The Secret in the Bible – Tony Bushby pg 256)
Bushby also discovered that the Book of the Dead speaks of 22 major locations in relation to the Giza complex. As seen in part 12click here, Giza was designed as a representation of the concept of ‘as above, so below,’ ‘heaven on earth.’ It is no surprise that the Great Pyramids are portrayals of transformation, godhood, the tree of ‘life’ and ladders of ascension.
Russian scientists have pioneered in the study of “spin fields” which they say can travel at “billions of times greater than the speed of light.” (Yu.V.Nachalov, A.N.Sokolov: “Experimental investigation of new long-range actions.”) Something similar to these spin fields has been documented using Kirlian photography on a pyramid replica:
Twin Serpents
http://www.subtleenergies.com/ormus/tw/2serpents.htm
“Tony Bushby in his book “The Secret in the Bible” wrote:
“Whenever a light is shone down into a glass pyramid in exact scale or proportion as the Great Pyramid, a ‘Rainbow Serpent’ is created. The light provides a type of force or energy that, in turn, creates the vertical spiral of light, a serpent upraised, invisible in rock, but visible in a clear substance.
That is what the Ancient Egyptian Priesthood meant when they said, ‘A serpent lies coiled in the Great Pyramid’.”
Bushby suggests that the capstone of the Great Pyramid was a clear crystal or glass that produced a visible beacon of light from the apex of the pyramid:
“The Priesthood knowledge appears to directly reference the known existence of an invisible spiral force operating within the confines of the Great Pyramid, precisely in the same manner as the spiral of visible light was seen in the Benben. That explains exactly what the Benben originally was, but much larger; It was a clear pyramidal structure acting as a focal point to gather in, convert and distribute light from the sun into energy, and project its force deep into the heart of the Pyramid.”
“It appears the Benben was primarily intended as a type of amplifying principle to activate power into the specially designed chambers and passageways in the structure below. With the sun shining down upon it, a huge Rainbow Serpent was created and could be seen from miles away.”
Bushby suggests that the Rainbow Serpent was a double helix like DNA. He claims that the shadow from a double helix replica will form the ancient Hebrew alphabet of the Torah:
“For thousands of years, spiritual teachers of Jewish traditions claimed that the five major Hebrew texts making up the Torah were ‘holy’, of special significance, and of supernatural origin…. And they were right.
By producing an exact physical copy of the spiral shape of the Rainbow Serpent from plastic, brass, a strip of metal or a similar solid substance, its significance becomes apparent, and that item could best be described as ‘light descended into matter’.”
“It is the primary element of both the Book of Thoth and the Secret in the Bible and the precise twisty shape of the Rainbow Serpent provides the necessary form to physically demonstrate a major part of the Secret.
When the plastic or metal reproduction of the Rainbow Serpent is slowly revolved, 22 different shaped shadows are cast from that one element, and those shapes directly make up the 22 separate letters of the alphabet that the Torah was written in.”
“Put in the simplest terms, the alphabet in which the Torah of the bible was originally and secretly written was one composed of a series of 22 cosmic glyphs that emanated with ‘splendour and power in the form of a serpent’ from a vertical spiral of light in the Benben on top of the Great Pyramid in Egypt. Evidence of that knowledge points directly at the undeniable input of a higher intelligence, a superior mind source.”
“Embroidered gold beads and semiprecious stones delineate the double uraeus, which indicates the scissure between the two hemispheres of the brain.” (The Tomb of Tut-Ank-Amon II – Howard Carter)
Jeremy Narby found that the Egyptians were not the only people who associated the brain with the serpent.
In Desana shamanism, these tow serpents symbolize a “female principle and a male principle”, an image of father and mother, water and Earth. This union of opposites is intimately linked with the mark of the beast. More on this in part 12 – As Above, So Belowclick here.
Interestingly, the human brain is designed in a similar manner as a tree. The spinal cord is like the roots of a tree under the ground absorbing nutrients which are seen in the brain in neurons. The brain stem is similar to the root of the tree with the brain itself in the form of the branches and leaves. Scientists have recognized this connection as the nerve fibers which connect together like branches to send and receive communication from each other are called ‘dendrites.’ Dendrite is the Latin/Greek word for tree.
http://www.wisegeek.com/what-are-dopaminergic-pathways.htm
“Neurons, the cells in the brain, communicate by sending chemicals called neurotransmitters to other cells. Dopaminergic pathways are neural networks in the brain that transmit dopamine, a type of neurotransmitter. There are four major dopaminergic pathways in the brain: the nigrostriatal pathway, the mesolimbic tract, the mesocortical tract, and the tuberoinfundibular pathway.
Neurons in the brain are built like trees, with branches coming out of the cell body on all sides and a long trunk projecting away from the body. The neuron sends electrical signals down the trunk of the tree, called the axon. At the base of the axon, the neuron releases neurotransmitters, which travel across a gap called the synapse to interact with another neuron. The neurons in the dopaminergic pathways have long axons which run the entire length of the pathway.”
Notice here the imagery that is connected to the DNA molecule. The four pathways of the neuron is paralleled by the 4 nucleotides of the DNA molecule. The neurons send information down the ‘trunk of the tree’ called the axon. Axon comes from the word axis which means a straight line around which a body rotates. Here we see a shadow picture of the twisting DNA helix. Interestingly, the word for vertebra, which is the root of the ‘brain tree’ has a similar meaning. Vertebra comes from the Latin word ‘vertere’ meaning to turn and twist.
Further linking the brain to DNA and a tree is the word spine. The word spine traces back to the Latin word Spica which is related to the Hebrew word ‘tsemach’ which means the Branch, a reference to Messiah mentioned above.
This connection between the spinal cord and the brain and a tree is displayed in the letter gimel which will be discussed in more detail below in relation to the golem.
Ancient Sumeria:
Adams Alien Genes
http://www.norinvest.org/wp1/
“The Role of the Anunnaki:
Readers of my books [Zechariah Sitchin] must be smiling by now, for they know the answer.
They know that the biblical verses dealing with the fashioning of The Adam are condensed renderings of much much more detailed Sumerian and Akkadian texts, found inscribed on clay tablets, in which the role of the God in Genesis is performed by the Anunnaki Those Who From Heaven to Earth Came.
As detailed in my books, beginning with The 12th Planet (1976) and even more so in Genesis Revisited and The Cosmic Code, the Anunnaki came to Earth some 450,000 years ago from the planet Nibiru a member of our own solar system whose great orbit brings it to our part of the heavens once every 3,600 years. They came here in need of gold, with which to protect their dwindling atmosphere. Exhausted and in need of help in mining the gold, their chief scientist Enki suggested that they use their genetic knowledge to create the needed Primitive Workers. When the other leaders of the Anunnaki asked: How can you create a new being? He answered:
“The being that we need already exists; all that we have to do is put our mark on it.”
Notice that Sitchin links the manipulation of man’s DNA with the Anunnaki as putting their ‘mark’ upon man…
The connection between Sumeria, Egypt and South American and their mythologies are seen in more detail in part 12click here.
Kabbalah:
Mayan portrayal of the tree of Life:
Jeremy Narby connects the serpent to DNA in his book the Cosmic Serpent where he links ancient shamanism to modern day science’s molecular biology.
Narby links DNA with transformation and the serpent.
“DNA is a master of transformation: life based on cells informed by DNA has formed the air we breath, the landscape we see and the disturbing diversity of living beings which we are a part of. In four billion years it has multiplied itself in an incalculable number of different species, rigorously remaining the same.
Inside the nucleus, DNA forms curves and unrolls itself, it contours and oscillates. Frequently, specialists compare the shape and the movements of this large molecule with the ones of a serpent. Molecular biologist Christopher Wills, for example, writes: “The two DNA chains are similar to two intertwined serpents in a kind of love ritual.”
In sum, DNA is a master of transformation with serpent shape, which lives in the water, at the same time long and minuscule, simple and double. Such as the cosmic serpent.”
Notice the connection to the ‘ankh.’ Here we see a double serpent representing the DNA molecule and the ankh representing the chromosome which as mentioned above is in the shape of a cross.
In modern times this connection has been seen as well:
Notice the link between DNA, the serpent and man evolving into godhood.
DNA & Crystal
Liquid Crystalline DNA
http://micro.magnet.fsu.edu/micro/gallery/dna/dna.html
DNA is a crystalline structure. In fact, the double-helical structure of DNA was deduced from crystallographic data.
Single Crystal DNA. Notice the hexagonal formation…

DNA molecules are modeled as polygonal chains in simple cubic lattices.
Interestingly, the word for parchment is used in the New Testament (2 Timothy 4:13) as a translation of the Greek word membrane.
Whitaker’s Latin Dictionary
Membrana, Membranae
N – 1 1 – F –
membrane; skin; parchment;
Thin skin, film membrane. The skin of a snake or the skin prepared to write on a parchment like a scroll.
Kundalini
Another form of the serpent in the tree is the concept of kundalini which has been discussed throughout these series of studies. Kundalini is the teaching that a serpent is coiled at the base of the spine and through certain rituals will rise up the 33 bones of the spine to reach the pineal gland in the brain which opens up the ‘third eye’ of the initiate. This opening of the third eye is related to the alteration of the DNA of man.
Interestingly, the word for spine and tree are the same.

The serpent rises up the spine to the pineal gland which was represented in ancient cultures as the pine cone….the fruit of the pine tree.
The Kundalini serpent is also represented by the caduceus which portrays DNA.

The caduceus is discussed in more detail in part 5click here, it is a counterfeit of Messiah on the tree whose death brings life to the world. More on this below.
http://www.cabiz.net/heartlink/merkaba_dna.htm
“The twin serpents (towers) are said to represent the Ida and the Pingala, the two “tunnels” or pathways of psychic energy which reside in the body, and which channel and regulate the flow of psychic energy. This flow must become balanced into a central tube for the ‘kundalini’ spiritual energy to flow safely. The kundalini is directly augmented or suppressed in the body by the patterns of breath and breathing that each person uses. It is strengthened by meditation.
To be made whole/complete Osiris must have his Pillar… or his wyfe of the Divine Marriage (Chemical Wedding). This is describing what happens when the Kundalini (spiritual energy) rises through the chakras to the Pituitary Gland and joins the Cosmic energy in the Pineal Gland to form the Divine Marriage.
After undergoing numerous initiations one attains enlightenment symbolized by the presence of “the Elect,” or the 144,000 and fully functioning DNA. When the individual has mastered their own individual flow of energy, and unsealed or opened each chakra and its corresponding system of biochemical (endocrine glands) and organic energy, they then must face the final struggle, or Armageddon, which is the prerequisite for attaining the “eighth level” of psychic power.
The fully enlightened individual thus attains the Christ-consciousness which 888 symbolizes. They master the physical and metaphysical laws of karma, which is how the person becomes immortal and is freed from the necessity to reincarnate.”
Pineal – DNA Connection
Pineal Gland & DNA
http://justgetthere.us/blog/archives/Pineal-Gland-DNA-Activation-and-DMT.html
“Psychedelic Adventures
Some call it the 3rd eye or the mind’s eye, the pineal gland was the last endocrine gland to have it’s functions discovered as it is located deep at the center of the brain, almost hidden away like it were a secret from which comes the word secretion, which is what the pineal gland does. It secretes the hormone melatonin which affects our wake / sleep patterns, photoperiodic (seasonal / circadian) functions and also activates the dormant codons in our DNA often referred to as ‘Junk DNA’. Melatonin affects our biorhythms and the aging process …”
http://www.disclose.tv/forum/pineal-gland-dmt-dna-tetrahedron-2012-t11760.html
“The pineal is a superconducting resonator. Ananda [Bosman] claims it potentiates DNA as a multidimensional transducer of holographic projection, through hadron toroids, and is implicated in staying youthful. 5meoDMT & DMT act on the T-RNA messengers which carry out the protein synthesis for the DNA, or the rebuilding of our our body image and organs.
Melatonin is exclusively made in the pineal gland, comprised of the same Tryptophane base materials as Pinoline. Melatonin induces mitosis. It does this, by sending a small electrical signal up the double helix of the DNA, which instigates an 8 HZ proton signal that enables the hydrogen bonds to the stair steps, to zip open, and the DNA can replicate.
The human Pineal gland not only produces the neuro-hormone Melatonin, one of the body’s most potent antioxidents, but the revolutionary Pinoline, 6-methoxy-tetra-dydro-beta carboline, or 6-MeO-THBC. Pinoline is superior to Melatonin in aiding DNA replication. Pinoline can make superconductive elements within the body. It encourages cell division by resonating with the very pulse of life – 8 cycles per second – the pulse DNA uses to replicate. This 8 Hz resonance was measured in healers by Andrea Puharich in the late 1970s.
Ananda implicates DMT in the hyperdimensional geometry or architecture operating in DNA through hadronic mechanics, a model of the 8 hz, or universal phase-conjugational force, that is also the most coherent Nuclear Magnetic Resonance and the DNA replication frequency. He relates this to the sacred geometry of the Merkabah, Flower of Life, Sri Yantra, Diamond Body, and Vector Equilibrium Matrix.
The living DNA in our bodies operates in hyperdimensions. The entire body holographic message is present in the single DNA molecule, in order to be capable of reproducing the entire whole. The local 8hz field component is a standard tetrahedron interlocked with a second tetrahedron representing the counter-rotary field that it is phase-conjugating with, and together comprising a “stellated cube.”
5-MEO-DMT acivates the whole spine, the whole tree of life (Djedi, the staff of Hermes*, the Caduceus of the spine) becomes active to be reprogramed. This is the accessing and awakeing of the tree of life, the kundalini (which is a readout of the DNA, and the DNA is the tree of life in miniscal). So one can start to process the illusion of the dream from its binary code into the Unity Self.”
*The imagery of the serpent in the tree was passed down via the caduceus, mentioned in more detail in part 5. Interestingly, the name Hermes comes from the Hebrew word ערם ‘aram’ which means ‘cunning.’ This is the word used to describe the serpent in Genesis 3.
The pine cone is associated with the Sumerian Annunakiclick here who are said to have ‘created’ men from clay jars. More on this on the section on fallen angels and the Annunaki.
Fallen Angels/Annunaki & DNA alteration
The fallen angels descended on Mt Hermon which the inhabitants of that land called Sirion. Sirion in Hebrew comes from the root meaning to tie or to twist together. The allusion to manipulation to DNA is found in this Hebrew word as the word for navel, and relatives comes from this root as well.

Another prophecy associating Mt. Hermon with “twisted work”
Isa 17:1 The burden of Damascus: Behold, Damascus is taken away from being a city, and it shall be a ruined* heap**.
*The word ruin here is ‘naphal’ which refers back to the Nephilim. The word translated as heap is עי which means a ‘twisted work.’
Adam Kadmon
Adam Kadmon should be more properly spelled Qadmon as this word comes from the Hebrew ‘qedem’ which means ancient, referring to Adam in the Garden.
Rev 13:18 Here is wisdom: Let the one having reason count the number of the beast, for it is the number of a man (Heb. Adam) and its number is six hundred and sixty six.
ADAM KADMON = 666
http://www.biblemaster.com/qanda/display_topic_threads.asp?ForumID=20&TopicID=10481&PagePosition=1
“The first ideal form of the Man is in Adam Kadmon—the prototype of the Tiphereth form. This Tiphereth answers to the letter Vau of the Holy Name, as representing THE PRINCE. The letter Vau also represents the number Six and Adam was created on the Sixth Day, for Tiphereth is the symbol of the Creation.” (http://www.golden-dawn.org/gd_fr10.htm.) As seen in part 6click here, tipheret is associated with the hexagram.
“Now THE NUMBER OF THE BEAST is a number of a MAN …because IT IS THE Primordial man: “…for IT IS THE NUMBER OF ADAM…”
Again, by the “number of man” or “Adam” is meant “THE SEPHIROT (THE KABBALISTIC TREE) ARE ADAM” because the word Sephirot itself MEANS “ENUMERATIONS”.”
“THE TEN SPHERES OF THE KABBALISTIC TREE/ADAM KADMON IS EQUAL TO THE SQUARE OF THE SUN – 666”
0, the birth of all numbers = Sun, the Crown of Life
1, the first physical number = Mercury, the Intelligence of Life
2, the first reproduced number = Venus, the Wisdom of Life
3, the first plane number = Earth, the Beauty of Life
1+2+3=6
4, the structure of number = Mars, the Severity of Life
5, the expansion of number = Jupiter, the Love of Life
6, the harmony of number = Saturn, the Foundation of Life
4+5+6=15=1+5=6
7, the uniqueness of number = Uranus, the Splendor of Life
8, the power of number = Pluto, the Glory of Life
9, the deception of number = Neptune, the Kingdom of Life
7+8+9=24=2+4=6
{http://www.arcaneadvisors.com/nutol/tree_of_life-astro.htm.}
“The ADAM KADMON is the ultimate divine template for humanity… It IS NOW BEING RESURRECTED OR RECONSTRUCTED THROUGH THE USE OF the vibratory patterns contained with THE DIVINE NAMES, which are in turn formed from the Archangelic language(s). Thus as we incorporate these higher vibratory patterns into our own consciousness and genetic make-up, we BECOME CO-CREATORS IN THE RESURRECTION OF THE ADAM KADMON… Thus, the ADAM KADMON CAN BE SEEN AS A DIRECT MANIFESTATION OF THE TREE OF LIFE (THE TREE OF THE KNOWLEDGE OF GOOD AND EVIL). http://www.spiritmythos.org/holy/alphark2.html.”
“THE GNOSTICS AND MYSTICS BELIEVE THE LIE THAT ADAM KAMON/ALBION/LUCIFER IS THE HOLY GHOST –
ADAM KADMON, ANDROGYNOUS MAN, WHOSE BODY IS THE GALAXY AND ZODIAC, at whatever level of manifestation. …ALBION (ADAM KADMON)… WHO IS BURIED IN THE PIT OF THE EARTH… is the Holy Ghost caught in time, OTHERWISE KNOWN AS LUCIFER. ALBION/ADAM KADMON/ IS THE EXPRESSION OF LUCIFER in the context of Earth as elaborated THROUGH THE COLLECTIVITY OF HUMAN CONSCIOUSNESS … http://blueroomconsortium.com/pdfs/Article_New_Geom%20Foundation.pdf.”
“God places himself for display on earth in the likeness of the Jews…. The Hebrew is the living God become flesh, the heavenly man, the Adam Kadmon.”
Kaballa ad Penteteucum, Folio 97, Co. 3, cited in Maurice Pinay, The Plot Against the Church, p. 144.
Adam Kadmon: Primordial Man
http://www.newkabbalah.com/adam.html
“In the Kabbalah, the Primordial Man is spoken of as Adam Kadmon, and, in the Lurianic Kabbalah this symbol becomes a pivotal notion linking God, Man, and the World. Adam Kadmon, as the first being to emerge from the infinite Godhead, Ein-sof, is essentially indistinguishable from the deity, yet at the same time his body is said to both emanate and constitute the world. Man, having been created in God¹s image, is said by the Kabbalists to be comprised of the very same cosmic elements, the sefirot, which comprise the “body” of Adam Kadmon.”
“…As such, according to Luria, the Primordial Man is instrumental not only for the world¹s creation, but for its redemption as well. Still it is the province of actual men and women to assure the world’s Tikkun”

The Cabala: Chapter V. The Most Important Doctrines of the Cabala – Gershom Scholem pg 73
The Cabala: Chapter V. The Most Important Doctrines of the Cabala – Gershom Scholem pg 69-74
“The Divine Man.–As to the Adam Kadmon which is shown in the following figure, the Crown represents the head; Wisdom, the brains; Intelligence which unites the two and produces the first triad, the heart or the understanding. The fourth and fifth Sephiroth, i.e., Love and Justice are the two arms, the former the right arm and the latter the left; one distributing life and the other death. The sixth Sephirah, Beauty, uniting these two opposites and producing the second triad, is the chest. Firmness and Splendor of the third triad represent the two legs, whereas Foundation, the ninth Sephirah, represents the genital organs, since it denotes the basis and source of all things. Finally Kingdom, the tenth Sephirah, represents the harmony of the whole Archetypal Man.”
“So far as the Sephiroth represent the first manifestation of God they form a world for themselves, an ideal world which has nothing to do with the real, material world. As such it is now called the primordial, the Archetypal Man (Adam Kadmon), now the Heavenly Man (Adam Ilaî). As for the Adam Kadmon, different views exist in the cabalistic writings. He is sometimes taken as the totality of the Sephiroth, and he appears as a pre-Sephirotic first emanation and superior to them, by which God manifested himself as creator and ruler of the world, as it were a prototype (macrocosm) of the entire creation. In this case it would seem as if the Adam Kadmon were a first manifestation, inserted between God and the world, so to say a second God [δεύτερος θεὸς] or the divine Word. [λόγος.]”
Golem
The earliest stories of golems date to early Judaism. Adam is described in the Talmud (Tractate Sanhedrin 38b) as initially created as a golem when his dust was “kneaded into a shapeless hunk”. Like Adam, all golems are created from clay.
In many tales the Golem is inscribed with magic or religious words that keep it animated. Writing one of the names of God on its forehead, a slip of paper in its mouth, or inscribed on its body, or writing the word Emet (אמת, “truth” in the Hebrew language) on its forehead are examples of such words. By erasing the first letter aleph in Emet to form Met (מת, “dead” in Hebrew, when the aleph letter א is cancelled) the golem could be deactivated. Another way is by writing a specific incantation in the owner’s blood on calfskin parchment, and placing it in the mouth. Removing the parchment will deactivate the golem.
Angelo S. Rappoport in his book ‘The Folklore of the Jews’ on page 195-203 relates a story of the golem. Rappoport starts his story with the birth of a son to a man named Bezalel. Notice that the name is the same as the man who was given wisdom to build the Tabernacle. In the story of the golem, Bezalel’s son builds a counterfeit ‘tabernacle.’
One night Bezalel’s son heard a mysterious voice calling to him to ‘Make a human image of clay and thus you will succeed in frustrating the evil intentions of the enemies of Israel.’ Notice that this golem creature was to be a savior.
Rappoport then makes clear that the golem is made of the 4 elements. As seen in part 6click here, the combination of the 4 elements together brings forth ‘quintessence’ which is represented by the hexagram.
Bezalel’s son along with two other men ‘recited a cabalistic formula’ and gave life to the image of clay. The face of the figure looked to be of that of a man of thirty. Again notice the connection to Messiah. A savior who looks to be about 30 years old.
The Golem was named ‘Joseph’ which is another term for Messiah as Jewish thought speaks of Messiah ben David and Messiah ben Joseph.
“Rabbi Loew said of him that neither fire nor water had the power of harming him, nor could any sword wound him. He had called the man of clay Joseph, in memory of Joseph Sheda mentioned in the Talmud who is said to have been half human and half spirit, and who had served the rabbis and frequently saved them from great trouble.”
“The Golem’s power was quite supernatural and he performed many good deeds.”
“Rabbi Loew afterwards related many incidents connected with the creation of the Golem. When he was on the point of blowing the breath of life into the nostrils of the figure of clay he had created, two spirits had appeared to him; that of Joseph the demon and that of Jonathan the demon. He chose the former, the spirit of Joseph, because he had already revealed himself as the protector of the rabbis of the Talmud, but he could not endow the figure of clay with the power of speech because the living spirit inhabiting the Golem was only a sort of animal vitality and not a soul.”
Rev 13:15 And was given to it to give a spirit to the image of the beast, so that the image of the beast might even speak, and might cause as many as would not worship the image of the beast to be killed.
“It was afterwards related that every Friday Rabbi Loew used to remove the tablet on which he had written the Ineffable Name from under the Golem’s tongue, as he was afraid lest the Sabbath should make the Golem immortal and men might be induced to worship him as an idol.”
ADAM KADMON = 666
http://www.biblemaster.com/qanda/display_topic_threads.asp?ForumID=20&TopicID=10481&PagePosition=1
“In Jewish tradition A GOLEM IS AN ARTIFICIAL CREATURE (BEAST) CREATED BY SORCERY out of the primal elements, and usually FROM THE DUST OF THE EARTH LIKE THE FIRST ADAM. The TALMUD SAYS THE FIRST MAN ADAM WAS A “GOLEM” for the first 12 hours of his existence, as a “body without a soul”, as created from the dust of the ground… (Sanhedrin 38b).”
“The biblical book of the Revelation is relevant here, because it presents ISRAEL’S END-TIME ANTICHRIST AS A SORCERER OF THE CABBALISTIC SORT, WHO IS LIKE A GOLEM BECAUSE HE “COMES UP OUT OF THE EARTH”in opposition to and instead of Jesus Christ and as a counterpart of the first man Adam… Jewish tradition more specifically says A GOLEM CAN BE “ACTIVATED” or come alive if its creator walks or dances around it CHANTING… a combination of letters of the Hebrew alphabet and THE NAME OF GOD…
http://jewsribsinbearjaw.wordpress.com/2009/02/28/obama-a-jew-golem-and-a-frankensteins-monster/.”
“THE KABBALAH… includes legends and stories about the alchemical homunculus, or “little man,” and THE GOLEM, A KIND OF PROTO-FRANKENSTEIN’S MONSTER. In both cases the idea is that THROUGH CERTAIN SECRET MAGICAL PRACTICES, HUMAN BEINGS CAN SHARE IN THE CREATIVE POWER OF GOD…. the homunculus… is fashioned, molded from clay or soil and then is miraculously brought to life… TO ANIMATE A GOD IMAGE WAS TO…BRING THE GOD TO PHYSICAL MANIFESTATION.
For ancients like the philosophers …this meant DRAWING DOWN THE GOD-FORCE THAT RESIDED IN THE STARS AND EMBODYING IT IN THE IMAGE OF THE GOD…. In the Talmudic Aggadah, ADAM IS REFERRED TO AS “GOLEM.” In a midrash from the second and third centuries, Adam is described as a kind of COSMIC GOLEM, an immense being whose body is as large as the universe and who can see the entire history of the world, its past and future… This description relates to the kabbalistic idea, also shared by hermetic, alchemical, and Gnostic beliefs, that the universe itself is a kind of man, Adam Kadmon, and that each of us is a microcosm, a universe in miniature: the universe is a Great Man, and we are all little universes… …the golem is a creature, particularly a human being, made in an artificial way by virtue of a magic act, THROUGH THE USE OF HOLY NAMES. In kabbalistic tradition, the golem, like Adam, is made of clay or soil. He is molded into human form, and THEN THE MYSTICAL NAME OF GOD, THE TETRAGRAMMATON, JHVH, is written on a piece of paper and placed on his mouth… here the kabbalist echoes God’s creative power and creates a kind of life himself… There are different versions about …the golem… In the most popular one, the word emeth, “truth,” is written on the golem’s forehead, and this gives it life… in kabbalistic tradition, the golem always lacks some essential quality. http://www.theosophical.org/publications/questmagazine/janfeb06/Lachman/index.php.”
Idols in the Secret Place
Deu 27:15 Cursed is the man who makes a carved and molten image, an abomination to YHWH, the work of a craftsman’s hands, and who sets it up in a secret place (seter-as seen in part 2click here, this word is linked to 666) ! And all the people shall answer and say, Amen!
The Tabernacle = the Secret Place
Eze 7:22 I also will turn My face from them, and they shall defile My hidden place. And violent ones shall enter into it and defile it.
Our bodies = His Tabernacle/Temple. In the Holy of Holies dwells the Book/DNA.
Psa 139:15 My bones were not hidden from You when I was made in secret (seter); when I was woven (Heb. raqam – physically portrays the DNA helix) in the depths of the earth.
Psa 139:16 Your eyes saw my embryo (Hebrew – golem); and in Your book {linking to DNA} all my members were written the days they were formed, and not one was yet among them.
Psa 139:17 And how precious are Your thoughts to me, O God! How great is the sum of them!
Nebuchadnezzar’s Image
The image that Nebuchadnezzar made is linked to 666 and is the ‘prototype’ for the image spoken of in Revelation 13. It was 60 cubits tall and 6 cubits wide with 6 musical instruments played before it.
Dan 3:1 Nebuchadnezzar the king made an image of gold whose height was sixty cubits; its breadth, six cubits. He set it up in the plain of Dura, in the province of Babylon.
Dan 3:5 at the time you hear the sound of the horn (1), the pipe (2), zither (3), the lyre (4), harp (5), bagpipe (6), and all kinds of music, you shall fall down and worship the golden image that Nebuchadnezzar the king has set up.
36 square cubits
http://www.freewebs.com/watchman4wales/666parti.htm
“The total height being ten times that of the width, for the proportions of the sculpted figure to be correct it would have stood on a tall pedestal, much as in Nelson’s Column in Trafalgar Square; the appearance would have been something like the attempted reconstruction in the illustration above. The fact that Daniel only gives the width and not the depth is simply because it is not necessary to state the obvious: the base-plan is a square, 6 cubits x 6 cubits giving an area of 36 square cubits.
Basically, if you draw a 6 x 6 grid and enter the individual numbers 1 – 36, then it is a simple and irrefutable mathematical fact that if you add all the numbers together they make a grand total of 666!”
As seen in part 2click here, this refers back to the magic square of the sun.
Interestingly, Manly P. Hall links the image of Nebuchadnezzar to the Sephirot and Adam Kadmon.
Secret Teachings of All Ages pg 388
“The Sephirothic Tree is sometimes depicted as a human body, thus more definitely establishing the true identity of the first, or Heavenly, Man–Adam Kadmon–the Idea of the Universe. The ten divine globes
(Sephiroth) are then considered as analogous to the ten sacred members and organs of the Protogonos, according to the following arrangement. Kether is the crown of the Prototypic Head and perhaps refers to the pineal gland; Chochmah and Binah are the right and left hemispheres respectively of the Great Brain; Chesed and Geburah (Pechad) are the right and left arms respectively, signifying the active creative members of the Grand Man; Tiphereth is the heart, or, according to some, the entire viscera; Netsah and Hod are the right and left legs respectively, or the supports of the world; Jesod is the generative system, or the foundation of form; and Malchuth represents the two feet, or the base of being. Occasionally Jesod is considered as the male and Malchuth as the female generative power. The Grand Man thus conceived is the gigantic image of Nebuchadnezzar’s dream, with head of gold, arms and chest of silver, body of brass, legs of iron, and feet of clay.”
Dan 2:19 Then the secret* was revealed to Daniel in a night vision, and Daniel blessed the God of Heaven.
*The word here is the ‘raz’ in Aramaic which traces back to ‘raz’ in Hebrew
This secret image traces back to a tree, in particular a Cedar. It is the cedar from whence comes the Asherah which traces back in the Mysteries to the tree of knowledge and the Kundalini serpent. Interestingly, the English word cedar’s etymology is linked with ‘immortality.’
Tree of Knowledge & the Image
Man is made in the image of God
YHWH) (Genesis 1:26-27). The counterfeit is man made in the image of elohim (Malachim Psalm 8:5-Hebrews 2:7).
This can be seen from looking at trees. The shadow of a tree can’t deviate from the tree itself. The tree of Life’s shadow is the sons of God
(believers in Messiah), the tree of knowledge’s shadow is the sons of elohim/satan. The Seed of Messiah versus the seed of the serpent.
The seed of the serpent are the rebellious children spoken of by the prophet Isaiah.
Isaiah 30 connects the sin of the tree of knowledge to the making of an idol.
Isa 30:1 Woe to rebellious sons, declares YHWH, to make counsel (etsah- from etz-tree), but not from Me; and to weave* a covering web**, but not of My Spirit, in order to add*** sin on sin;
The above could be translated as ‘to make counsel (root from עץ etz, a tree), but not from Me; that cast an image, but not of My Spirit, in order to consume sin on sin.
*The word translated above as weave is from the Hebrew ‘nasakh’ which means to pour out or to cast as in the making of an image/idol.
**’Covering web’ is from ‘massekah’ which comes from the same root as ‘nasakh’ and can mean a web, veil, woven stuff, or molten images/gods.
***’add’ is from ‘saphah’ which can mean to consume or the lips as in consumption via eating.
Isaiah then goes on to call these people ‘beasts’
Isa 30:6 The burden of the beasts of the south: Into the land of trouble and constraint. The lioness and the lion are from them; the viper and fiery flying serpent. They carry their riches on the shoulders of young asses, and their treasures on the humps of camels, to a people who cannot profit them.
This will occur in the latter days
Isa 30:8 Now come, write it before them on a tablet, and note it on a book, so that it may be for the latter day, until forever;
There are more allusions to DNA & the mark in Isaiah 30. Verse 10 speaks of prophesying deceits. Deceit comes from the root ‘tal’ which means twisted rope. Verse 12 states that they trust in perverseness. Perverseness here comes from ‘luz’ which according to rabbinic thought is the base of the spine, also the land where Jacob saw the vision of the ladder. Verse 25 speaks of the towers falling, tower comes from ‘migdal’ which comes from ‘gadol’ which means a twisting of fibers. The Assyrian (antichristclick here) mentioned in verse 31 comes from ‘shor’ which also means twisting fibers, specifically an umbilical cord.
As discussed previously in these series of studies, it is said in Rabbinic writings that the serpent appeared to Eve as a camel. The camel (gamal) is related to the golem as they are spelled with the same Hebrew letters.
God is a Verb pg 43
“The word ‘camel’ in Hebrew is gamal, which is the same word for the Hebrew letter gimel. Gimel, in the Hebrew alphabet, represents the number three.”
God is a Verb pg 43 ft note 24
“The Hebrew letter gimel, when spelled out, uses the letters gimel, mem and lamed. The word golem uses the same letters. It is the word for the Frankenstein-like creatures that ancient Kabbalists are said to have created by using magical formulas of various names of God. The numeric value of golem or gimel is the same as chochma, which is usually defined as wisdom.”
Notice here that Kabbalistic thought equates the serpent/camel with wisdom and the golem creature mentioned above.
As seen in part 13click here, wisdom = 73 which can be displayed as a hexagonal holograph linked to creation and the first verse of the Bible.
The Creation Hyperholograph – Richard McGough
http://www.biblewheel.com/gr/GR_Creation.asp
“The first verse of the Holy Bible is the foundation of the Creation Holograph. Its depth knows no limit. Its everlasting perfection glorifies the Lord God beyond measure. The text consists of 7 words and 28 letters:
The sum of the entire verse is the 73rd Triangular Number:
The prime Numbers 37 and 73 are geometrically integrated. They form the fourth term in the sequence of Hexagon/Star pairs (the first term being the trivial pair 1 / 1).
The Number 37 appears in two Hexagon/Star pairs. It is the Star in the 19/37 pair and the Hexagon in the 37/73 pair. This is an extremely rare property. There are only twelve numbers less than seven thousand trillion that can be represented both as a Hexagon and a Star. The Number 37 is the only such number less than a thousand. To find it embedded in the heart of Genesis 1.1 is a clear sign of divine design, especially when coupled with the fact that it is also the geometric basis of the Logos Star which represents God’s creative Word in the form of a fractal snowflake.
The Numbers 37 and 73 are an extremely significant pair of primes. The essential significance (singlular!) of this palindromic pair of prime numbers is found in these identities generated by the Hebrew word Hokmah (Wisdom):
According to the above author, David Cooper, Rabbi Eliezer says that the serpent was represented as a camel because of the number 3. “Mathematically, the number three is necessary for the physical world, which is three-dimensional – composed of three lines of direction: north-south, east-west, and up-down.”
God is a Verb pg 43
“In Kabbalah, Satan is said to represent the physical universe. Indeed, the universe as we know it is referred to in mystical writings as ‘the skin of the serpent.’ In the mystical cosmology of the Garden of Eden, the archetype of the serpent merges with the life-force, the form and substance represented by Adam and Eve. Once the serpent is able to merge with this life-force, the mystical formula is complete for the metaphysics of creation.”
The Sephirot (Kabbalistic ‘Tree of Life’) has multiple allusions to the Beast. It is linked to the 7 heads and 10 horns of the beast as it is said that the seven lowers sephirot ‘carry’ the ten horns or powers of the sephirot.

Nebuchadnezzar’s image consisted of 4 parts. This is equivalent to the ‘4 worlds’ of Kabbalah.
Atziluth which is corresponds to Babylon. This is equivalent to the ‘head of Adam Kadmon.’ Briah corresponds to the Medes and Persians, Yetzirah corresponds to Greece and Asiyah corresponds to Rome.
“THESE FOUR WORLDS ARE ILLUSTRATED IN THE SYMBOL OF THE MAN OF ZOHAR: ADAM KADMON…WHO HAS HIS FEET ON THE EARTH.
http://gnosticteachings.org/courses/twenty-two-arcana/arcanum
gnosticteachings.org/courses/…two…/arcanum-16-transcription
THE QABBALISTS ALSO ESTABLISHED A MYSTERIOUS UNIVERSAL MAN with his head at A 1 and his feet at D 10. BLUE]THIS IS probably THE SECRET SIGNIFICANCE OF THE GREAT FIGURE OF NEBUCHADNEZZAR’S DREAM, with its head in the World of Atziluth, its arms and hands in the World of Briah, its generative system in the World of Yetzirah, and its legs and feet in the World of a**iah. This is the Grand Man of the Zohar…
http://www.sacred-texts.com/eso/sta/sta28.htm.”
“…Thus the COSMIC ANDROGYNE is in reality the Grand Man of NEBUCHADNEZZAR’S DREAM, with head of gold and feet of clay.”
(The All Seeing Eye – Manly P. Hall)
“The 10 Sephirothic Globes – To each of these spheres or globes the Hebrews assigned one of the ten great Names of God, one of the ten archangels, one of the ten angelic powers, one of the ten parts of the sidereal world, and one of the ten demons of the underworld. …The Sephirothic globes are considered as planes of Nature…each globe contains within itself the energies of the of the other spheres emanating from it. For this reason the Sephiroth are often shown as A SERIES OF CONCENTRIC RINGS…
The first three Sephiroth constitute the Triad, (trinity/triangle) which is the foundation of the world. The remaining seven parts are divided into six “Days” of Creation and the “Sabbath” of rest. Thus, Creation is the process of the Divine Life descending according to the order of the numbers from Kether to Malchuth….
The ten parts of Creation – the Sephiroth – assigned to various sections of a great human body. The human figure is THE CELESTIAL ADAM (ANTICHRIST) – the Great Man – in whose “image” the human man was created. ..Kether, the Crown, representing the spiritual center… (Babylon) Chockmah and Binah – the Father and Mother – are the two hemispheres of the cerebrum. Chesed and Geburah are the arms – the active parts of the Great Man. (Medes & Persians) Tiphereth is the heart and …the entire trunk of the great body (Greece). Netsah and Hod are the two legs, or the supports of the universe (Rome). Jesod is the male generative power, and Malchuth both the feet and the female generative power. Thus the Cosmic Androgyne is in reality the Grand Man of Nebuchadnezzr’s dream, with head of gold and feet of clay.”
(The All Seeing Eye – Manly P. Hall)
Kabbalah
The Apostle Paul warns of the Kabbalah.
Col 2:4 And I say this that no one may beguile you with persuasive words.
1Co 2:4 And my word and my preaching was not in enticing words of human wisdom, but in proof of the Spirit and of power,
The word ‘enticing’ in Greek is πειθός (peithos) which is used in the Septuagint to translate the word ‘qabal’ from whence comes the word Kabbalah. According to Robertson’s Word Pictures “The kindred word pithanologia occurs in Col_2:4 for the specious and plausible Gnostic philosophers.”
Col 2:4 And I say this that no one may beguile you with persuasive words.
Notice that persuasive words are associated with beguiling. This is a direct reference to Genesis 3:13. The word for beguile in Genesis 3:13 is ‘nasha’ which also means a loan or debt. More on this below on the section on gold.
Sephirot
The most important aspect of the Kabbalah is the ‘Sephirot’ which is called the tree of life, but in reality is the tree of knowledge.
In the Kabbalah, the Sephiroth (or Enumerations) are the ten emanations of God (or infinite light: Ain Soph Aur) into the universe. These emanations manifest not only in the physical part of the universe, but also in the metaphysical one. Kabbalah distinguish four different worlds or planes: Atziluth, or World of Emanations, where the Divine Archetypes live; Beri’ah or World of Creations, where Highest Ranking Angels are; Yetzirah or World of Formations is the astral world; and Asiyah or World of Actions, is the physical plane and “low astral” plane. Each of these worlds are progressively grosser and denser, but the ten Sephiroth manifest in all of them.
The Sephiroth constitute the ‘tree of life’, and are aligned in three columns, each headed by a Supernal.
The names of the Sephirot are:
Kether (Crown)
Chochman (Wisdom)
Binah (Understanding)
Chesed (Mercy)
Gevurah (Severity)
Tiphareth (Redeemer)
Netzach (Victory)
Hod (Majesty)
Yesod (Foundation)
Malkhuth (Kingdom)
Sephirot comes from the Hebrew word ‘sepher’ which means a book. As seen in part 1click here, the mark is associated with a book. The mark of YHWH is the Torah (Bible), which is the Tree of Life. The mark of the beast is a ‘poison book’, the tree of knowledge.
Kabbalah comes forth from Mystery Babylon
“Kabalah (Heb.) The hidden wisdom of the Hebrew Rabbis of the middle ages derived from the older secret doctrines concerning divine things and cosmogony, which were combined into a theology after the time of the captivity of the Jews in Babylon. All the works that fall under the esoteric category are termed Kabalistic.” (H.P. Blavatsky, Theosophical Glossary, p. 168)
“The Pythagorean idea of the creative powers of numbers and letters, upon which the ‘Sefer Yetzirah’ is founded, and which was known in tannaitic times…is here proved to be an old cabalistic conception. In fact, the belief in the magic power of the letters of the Tetragrammaton and other names of the Deity…seems to have originated in Chaldea (see Lenormant, ‘Chaldean Magic,’ pp. 29, 43). Whatever, then, the theurgic Cabala was …, the very fact that Abraham, and not a Talmudical hero like Akiba, is introduced in the ‘Sefer Yetzirah,’ at the close, as possessor of the Wisdom of the Alphabet, indicates an old tradition, if not the antiquity of the book itself…
“The whole dualistic system of good and of evil powers, which goes back to Zoroastrianism and ultimately to old Chaldea, can be traced through Gnosticism; having influenced the cosmology of the ancient Cabala before it reached the medieval one…
“The gradual condensation of a primal substance into visible matter, a fundamental doctrine of the Cabala, … is the ancient Semitic conception of the ‘primal ocean,’ known to the Babylonians as ‘Apsu’ (compare Jastrow, ‘Religion of Babylonia’), and called by the Gnostics βύθος = (Anz, ‘Die Frage nach dem Ursprung des Gnostizismus,’ p. 98).”
Sephirot and Asshur
The oldest versions of the Jewish mysticism have been theorized to extend from Assyrian theology and mysticism. Dr. Simo Parpola, a researcher at the University of Helsinki, has made some suggestive findings on the matter, particularly concerning an analysis of the Sefirot. Noting the general similarity between the Sefirot of the Kabbalah and the Tree of Life of Assyria, he reconstructed what an Assyrian antecendent to the Sepiroth would look like.
He matched the characteristics of En Sof on the nodes of the Sepiroth to the gods of Assyria, and was able to even find textual parallels between these Assyrian gods and the characteristics of god. The Assyrians assigned specific numbers to their gods, similar to how the Sepiroth assigns numbers to its nodes. However, the Assyrians use a sexagesimal number system, whereas the Sepiroth is decimal. With the Assyrian numbers, additional layers of meaning and mystical relevance appear in the Sepiroth. Normally, floating above the Assyrian Tree of Life was the god Assur, this corresponds to En Sof, which is also, via a series of transformations, derived from the Assyrian word Assur.
Kabbalah & Alchemy
UNVEILING ALCHEMY
An Ancient Science for a Modern World
http://www.universalkabbalah.net/class_descriptions/#SepherYetzirah
“Alchemy is the Science of the Soul, designed for achieving spiritual perfection via very specific and comprehensible steps. As one of the oldest sciences on the planet, it’s primary goals are to accelerate spiritual evolution and to aid in perfecting physical creation. Through alchemy, one’s vibration may be heightened utilizing both practical and spiritual processes, thereby clearing negative patterns and purifying the body, mind, and soul.
Two of the main pillars of western occultism are Alchemy and the practical Kabbalah. Both work with the Tree of Life, a map for creation, which shows humankind how to consciously join together with the forces of evolution and it gives individuals the opportunity to transform themselves and their world. This is about becoming a fully actualized human, known to the kabbalists as the Adam Kadmon or ‘perfected god-like human’, in all areas of one’s life.”
The basic teaching of Qabalah is found in the 32 Paths of Wisdom upon a ” Tree of Life”, as stated in its oldest written text called the Sepher Yetzirah, translated as Book of Formation. These 32 paths are divided into the 10 numbers from 1 to 10 and the 22 letters/symbols of the Hebrew alphabet. Everything was created out of these 32 Pathways of Wisdom, and Man, as stated in the Bible, being in the “image and likeness” of YHVH, the Soul of the Qabalah, male/female, is said to be the most perfect and complete expression of these 32 Paths, a veritable Tree of Life. This would explain why the Essenes revered the tree, symbolically and in reality, and considered its fruit the best food for a human’s diet. Taking this concept of each of us as a Tree of Life with 32 Paths of Wisdom, it should manifest in our bodies. Sure enough, we need look no further than two of the most fundamental structures of our bodies, which bear considerable responsibility for our health and beauty: the spine and teeth, both normally comprised of 32 structural elements. And there’s more: 32 corresponds to our 10 fingers upon which we count numbers and do the creative outer work of our DNA, and 22 corresponds to our chromosomes, minus the one that determines gender. Timothy Leary’s book “The Game of Life”, written in the 1980’s, relates the 23 chromosomes to the 22 Hebrew letters and 22 major arcana of the Tarot.
Finally, Cabalism is pure Illuminism because it teaches the secret doctrine that, ultimately, the higher level adept learns: That the Holy Serpent is the true God; that all the evil that a person does, through alchemy, is magically transformed into righteousness; and that, yes, Lucifer is Lord. Satan is the true and only God. That is the essential doctrine of Cabalism.
Two of the main pillars of western occultism are Alchemy and the practical Kabbalah. Both work with the Tree of Life, a map for creation, which shows humankind how to consciously join together with the forces of evolution and it gives individuals the opportunity to transform themselves and their world. This is about becoming a fully actualized human, known to the kabbalists as the Adam Kadmon or ‘perfected god-like human’, in all areas of one’s life.”

Between the 10 Sephiroth run 22 channels or paths which connect them, a number which can be associated with the 22 letters of the Hebrew alphabet and on a deeper level DNA. The basic teaching of Qabalah is found in these ‘32 Paths of Wisdom’ upon a ” Tree of Life”, as stated in its oldest written text called the Sepher Yetzirah. Everything was created out of these 32 Pathways of Wisdom, and Adam, as stated in the Bible, being in the “image and likeness” of YHVH, the Soul of the Qabalah, male/female, is said to be the most perfect and complete expression of these 32 Paths, a veritable Tree of Life. This would explain why the Essenes revered the tree, symbolically and in reality, and considered its fruit the best food for a human’s diet.
Their tree of life seems to follow the premise:
“As is above–so is below.”
The ‘merkabah’ is the most important aspect of Kabbalah for its students. The merkabah is a representation of union with the divine based upon Ezekiel chapter 1. More on this below.
Sephirot & Jacob’s ladder
Aryeh Kaplan says the Sephirot can only be seen in brief glimpses, like brief chimera seen in one’s peripheral vision, and that their invocation must be repeated by method of approach and retreat, like the angels going up and down Jacob’s ladder. (Genesis 28:12)
The Sephirot are like rungs of the ladder, connecting Earth to Heaven, time to timeless, now to forever.
THE TREE OF LIFE AND FOUR WORLDS
http://www.yashanet.com/studies/revstudy/rev6.htm
“There are essentially two ways of approaching the Tree of Life. To put it simply, one can study it from the “top-down” or from the “bottom-up.” The study of the Tree from the “top-down” is an analysis of the process of creation, beginning with what we can know about God, going through the heavenly realms, then down to earth and man himself. In Kabbalistic tradition, this has been called the Work of Creation, and stems from the first chapters of Genesis.
Conversely, the “bottom-up” approach begins with man, including his physical, psychological and spiritual makeup, continuing his spiritual journey “up Jacob’s Ladder,” into the spiritual realms, toward God. This method of study has traditionally been based on an analysis of Ezekiel’s vision, and is called the Work of the Chariot.”
Divine Energy
http://www.safed.co.il/divine-energy.html
“Kabbalistic texts depict the Sephirot as running in a vertical manner across three axes or “Kavim,” running parallel to each other. Each axis stands for an aspect of the Divine influence as it affects Creation. The literature refers to the depiction of the Ten Sephirot as a “Sulam” (ladder) an “Etz” (tree) or a “Tzelem Elokim” (image of God). The latter expression is a reference to chart’s resemblance to the human form, which according to the biblical text, was created according to the image of God. Continuing with this same analogy, each Sephira is linked to specific organs or limbs corresponding to their position within the Sephirotic structure.”
Adam Kadmon & the 613 commandments
“It is well known in Judaism that there are a total of 613 Commandments in the Torah. 365 prohibitions and 248 affirmative commandments. The 365 negative commandments correspond to the blood vessels in the body and relate to the animal soul which is prone to do evil and the 248 positive commandments relate to the limbs of our body that does not want to do good. So when we subject our entire being to G-d in subjugating the animal soul not doing the prohibitive commandments and when we make our limbs perform the positive commandments we become a Chariot of G-d a form of Adam Kadmon.”
This is a perfect picture of the tree of knowledge of good and evil. It is a counterfeit of the tree of life. It represents good as well as evil. There are not 613 commandments in the Torah. Take a look at this list, and you will see that it is man’s interpretation of the Torah. This is what the tree of knowledge of good and evil is. A mixture of the Word and man’s interpretations.
Even in Kabbalistic thought, the Sephirot represent a mixture of the Tree of Life (the Word) and the tree of knowledge (religion)
“What we are present to in this configuration of pillars is the idea of three powers: the powers of the left (darkness), the powers of right (light) and the power of the soul, for the middle pillar is also called the Shekinah, the feminine counterpart of G-d. There is also some Kabbalistic speculation about the suggestion that the center pillar is the Tree of Life and the remaining pillars the Tree of Good and Evil.” (Kabbalah – Charles Ponce)
The Kabbalistic writers claim that the Messiah will come as a result of the Kabbalah.
An Entrance to the Tree of Life – Yehuda Ashlag pg 32
“From the year 1540 onward, it is most important that all study the Kabbalah in public and preoccupy themselves with the study of Kabbalah. For through the merit of Kabbalah and in fact solely through Kabbalah will the Messiah appear and forever efface war, destruction, social injustice, and above all, man in humanity.”
According to Kabbalistic doctrine, this will occur when ‘perfect knowledge’ is attained…the tree of knowledge
An Entrance to the Tree of Life pg 49
“However, it is necessary to understand that the redemption and the coming of the Messiah who is awaited by us, (may he come speedily, Amen!), will only occur when the pinnacles of perfect wisdom and knowledge have been reached. As it is written (Jeremiah 31:33): ‘And no more shall a man teach his neighbour to know the Lord, for all will know Me, from the youngest of them to the oldest of them…’ And with the perfection of knowledge there will also come perfection of the physical bodies, as it is written (Isaiah 65:20): ‘For the youngest shall die a hundred years old.’ “
An Entrance to the Tree of Life pg 51
“For it is impossible to imagine at all a perfect physical body without the attaining first of perfect knowledge…However, when perfect knowledge is attained then the physical body also reaches its perfection with it together…’Through this composition will the people of Israel leave the Exile.’ For it will only be as a result of the spreading of the wisdom of the Kabbalah amongst the masses of the people that we will be worthy of achieving the complete redemption.”
Notice that Kabbalistic thought links this perfection to the New Covenant. As seen in part 1click here, the mark is linked to covenant relationship. The covenant with YHWH through Jesus
or the covenant of death.
God is a Verb pg 85
“Thus only four amino acids, coupled into two pairs, offer an almost unlimited prospect for variation. This is precisely the same model that Kabbalists have used for a thousand years. Rather than amino acids, the Kabbalists have described four key elements of creation: expansion (chesed), which always pairs with contraction (gevorah); and giving (netzach), which always pairs with receiving (hod).
David Cooper links these ‘four elements of creation’ to the ladder seen by Jacob. This ladder is equated with the ‘sacred chariot.’
Merkaba
The ‘ma’aseh merkabah’ (work of the chariot) is a Kabbalistic term for ‘ascenscion’ into a higher spiritual reality. It is based upon the vision of Ezekiel 1. The merkabah is linked to the tetrahedron/hexagram as well as DNA and transformation.
The Jewish Religion: Its Influence Today – Elizabeth Dilling pg 96
The Ma‘aseh Mercabah and Ma‘aseh Bereshit are called in Judaism, the very basis of this occult gnosticism. Pretending to be based upon Genesis and Ezekiel’s chariot throne of God vision (Ezekiel I), this last “mystery” is called “Merkabah.” The words “by other means” are the most significant in the definition of the Merkabah in the Jewish Encyclopedia (pages 499-500): “The mysteries rest on the belief in the reality of things seen in an ecstatic state brought about by ablutions, fast, fervent invocations, incantations, and by other means … the Merkabah rider must provide himself with amulets or seals containing mysterious names … The central figure in the theophany, however, is the ‘Prince of the Face,’ Metatron…He is the one who imparted to man all the knowledge of heaven and of the past and the future.”
http://www.crystalinks.com/merkaba.html
“Merkaba, also spelled Merkabah, is the divine light vehicle allegedly used by ascended masters to connect with and reach those in tune with the higher realms. “Mer” means Light. “Ka” means Spirit. “Ba” means Body. Mer-Ka-Ba means the spirit/body surrounded by counter-rotating fields of light, (wheels within wheels), spirals of energy as in DNA, which transports spirit/body from one dimension to another. “
“In modern esoteric teachings, it is taught that the MerKaBa is an interdimensional vehicle consisting of two equally sized, interlocked tetrahedra of light with a common center, where one tetrahedron points up and the other down. This point symmetric form is called a stella octangula or stellated octahedron which can also be obtained by extending the faces of a regular octahedron until they intersect again.
In his books, researcher and physicist Drunvalo Melchizedek describes this figure as a “Star Tetrahedron”, since it can be viewed as a three dimensional Star of David. By imagining two superimposed “Star Tetrahedrons” as counterrotating, along with specific “prana” breathing techniques, certain eye movements and mudras, it is taught that one can activate a non-visible ‘saucer’ shaped energy field around the human body that is anchored at the base of the spine.”
Star of David, Merkaba & DNA
http://huenergy1.blogspot.com/2008/11/star-of-david-merkaba-dna.html
“DNA, the ancient cabalistic “Tree Of Life” (refer below) portrayed in the Biblical Torah, is now coming to be viewed as a live vibrating structure, rather than a fixed tape recording. Many modern scientists, regard DNA as a shimmering, waveform configuration, able to be modified by light, radiation, magnetic fields or sonic pulses. The legacy of Thoth/Enoch suggests this “language of Light”, the harmonic science of the ancients, could actually affect DNA.
The Merkaba spirals us – by virtue of our DNA – out of this reality and spiral/ spins us from one reality to another.
6 pairs of twin strands – 6 is Star of David and Merkaba (12 Strands – 12 Tribes)
We all have a Merkaba field around us. We use it to connect with the higher dimensions. It is the divine light vehicle used by the Masters to connect with and reach those in tune with the higher realms. This also balances our Yin/Yang – duality – polarity – electromagnetic energies.
In the sacred mystery schools sacred geometrical exercises were the bases of their beliefs. It was understood that in order to transform your physical body into light that you had to create an energy field of light around you in order to separate you from the lower vibrations.
The Mer-Ka-Ba is the vehicle of Light mentioned in the Bible by Ezekiel.
“Mer” means Light. “Ka” means Spirit. “Ba” means Body.
The Merkaba rotates when activated. Mer-Ka-Ba means the Spirit / Body surrounded by counter-rotating fields of Light, (wheels within wheels), spirals of energy as in DNA, which transports Spirit / Body from one dimension to another.
Merkaba can take on many forms of light. It is made up of two star tetrahedrons.
The Merkaba can connect into the grid systems of the earth, the Christ Grid and other Grid Systems.
The Merkaba serves to balance all chakras, and lead one into whole-brain synchronization.
Merkaba meditation incorporates pranic breathing techniques, which brings Life Force Energy directly into the body.”
UFO connection
The ‘merkaba’ is based upon Ezekiel chapter 1 where Ezekiel saw Messiah on His throne. This has been used by many UFOlogists to claim that the supernatural occurrences in the Bible were in reality ET visits. This has been made ‘mainstream’ by programs on the History channel.UFOs in the Bible
Gold & DNA
Blood and Gold – Michelle Emerson
“When one looks at a drop of blood under a microscope, its color is gold … sparkling, shiny beautiful GOLD. Now translate that beauty into the way we have valued gold over the millennia.
Why is this planet so in awe of the beautiful metal? One of the least recognized reasons is that liquid gold holds cellular/genetic and geophysical memory. Ancient archetypal symbols are being activated through the golden conductive properties within us.
For the alchemist, gold represented the perfection of all matter on any level, including that of the mind, spirit, and soul. If we take time to look into the science and spirit of gold we will find many interesting similarities and understand that the purest aura around the body is golden-white light.
In the beginning … golden threads combined with blood, to create a bloodline that carries the DNA code for the movement of consciousness in the alchemy of time.”
In the symbolism of Kundailini Yoga the opposites that are being mediated are the body and mind [analagous to matter and spirit] and the axis image that is used is the spinal column. The Kundalini Energy is envisioned as a serpent rising upwards in the body, through paths associated with three channels or pillars. You will note that while Kundalini uses physical methods and physical images, that the real goal is the transmutation of the material into the spiritual, just as in Alchemy where the metaphor that is used is that of converting gross matter into Gold.
Gold & Godhood
Gold is linked to 666
1Ki 10:14 And the weight of the gold that came to Solomon in one year was six hundred and sixty six talents of gold,
Laurence Gardner in his book, Lost Secrets of the Sacred Ark, brings forth evidence that gold was used by the ancients in their temples in an alchemical type process towards ’godhood.’
Lost Secrets of the Sacred Ark pg 15
“Elias Ashmole, and other of his day, produced a work in 1667 entitled Secrets Revealed. In this treatise he discussed the nature of the Philosopher’s Stone, which was commonly thought to transmute base metal into gold. Setting the record straight, Philalethes made the point that the Stone was itself made of gold, and that the alchemical art was in perfecting this process. He stated: ‘Our Stone is nothing but gold digested to the highest degree of purity and subtle fixation…Our gold, no longer vulgar, is the ultimate goal of Nature’.”
Gardner believes that the ancients ground the gold into powder to become a type of bread/manna.
This is linked to the golden calf.
Exo 32:20 And he took the calf which they had made and burned it with fire and ground it until it was fine, then he scattered it on the face of the water. And he made the sons of Israel to drink it.
Gardner describes this golden bread as the mfkzt of the Egyptians. This substance was described as a ‘Precious Stone’ which was presented to the Pharaohs to ‘give them life.’ The ‘white powder bread’ was perceived as a giver of life and was made from gold.
Lost Secrets of the Sacred Ark pg 19
“…the mfkzt plainly enhanced their lives in some way, and very likely extended their potential life spans beyond the norm. In this respect, it was akin to the enigmatic Fountain of Youth in popular Middle Ages romance.”
“It was from the milk of Hathor that the pharaohs were reckoned to gain their divinity, becoming gods in their own right. They were said to feed on the milk of Hathor just as the Babylonian kings had fed on the milk of Ishtar. It would appear that since natural mothers’ milk contains the enzyme telomerase, the mfkzt (the symbolic milk of Hathor) must somehow have enhanced production of this enzyme. Indeed, modern scientists have now described telomerase as being the ‘fountain of youth.’”
Lost Secrets of the Sacred Ark Pg 19-20 Gardner describes these telomeres as ‘caps’ at the end of DNA strands.
“As reported in the journal of Science, along with reports from corporate studies and those of the University of Texas Southwestern Medical Center, it has been determined that telomerase has unique anti-ageing properties. Healthy body cells are programmed to divide many times during a lifetime, but this process of division and replication is finite, so that a non-dividing state is ultimately achieved. The division potential is controlled by caps at the end of DNA strands, and these caps are the telomeres. As each cell divides, a piece of telomere is lost, and the dividing process ceases when the telomeres have shortened to an optimum and critical length. There is then no new cell replication and all that follows is deterioration – ageing.
Laboratory experiments with tissue samples have shown that the application of the genetic enzyme telomerase can prevent the shortening of the telomeres upon cell division replication…It seem, then, that somewhere within our DNA structure (presumably in what is commonly termed ‘junk DNA’) is the genetic ability to produce this anti-ageing enzyme, but the potential has somehow been switched off.”
Manna
Rev 2:17 The one who has an ear, hear what the Spirit says to the assemblies. To the one overcoming, I will give him to eat from the hidden manna. And I will give to him a white stone, and on the stone a new name having been written, which no one knows except the one receiving it.
The Lord Jesus said that this manna refers to Himself. He calls it the bread of LIFE. He associates this manna with eternal life and the Word.
Messiah is the bread from Heaven that gives Life
Joh 6:30 Then they said to Him, Then what miraculous sign do You do that we may see and may believe You? What do You work?
Joh 6:31 Our fathers ate the manna in the wilderness, as it is written “He gave them bread out of Heaven to eat.” LXX-Psa. 77:24; MT-Psa. 78:24
Joh 6:32 Then Jesus said to them, Truly, truly, I say to you, Moses has not given you the bread out of Heaven, but My Father gives you the true bread out of Heaven.
Joh 6:33 For the bread of God is He coming down out of Heaven and giving life to the world.
Joh 6:34 Then they said to Him, Lord, always give us this bread.
Joh 6:35 Jesus said to them, I am the Bread of life; the one coming to Me will not at all hunger, and the one believing into Me will not thirst, never!
Joh 6:36 But I said to you that you also have seen Me and did not believe.
Joh 6:37 All that the Father gives to Me shall come to Me, and the one coming to Me I will in no way cast out.
Joh 6:38 For I have come down out of Heaven, not that I should do My will, but the will of Him who sent Me.
Joh 6:39 And this is the will of the Father sending Me, that of all that He has given Me, I shall not lose any of it, but shall raise it up in the last day.
Joh 6:40 And this is the will of the One sending Me, that everyone seeing the Son and believing into Him should have everlasting life; and I will raise him up at the last day.
Joh 6:41 Then the Jews murmured about Him, because He said, I am the Bread coming down out of Heaven.
Joh 6:42 And they said, Is this not Jesus the son of Joseph, of whom we know the father and the mother? How does this One now say, I have come down out of Heaven?
Joh 6:43 Then Jesus answered and said to them, Do not murmur with one another.
Joh 6:44 No one is able to come to Me unless the Father who sent Me draws him, and I will raise him up in the last day.
Joh 6:45 It has been written in the Prophets, They “shall” all “be taught of God.” So then everyone who hears and learns from the Father comes to Me; Isa. 54:13
Joh 6:46 not that anyone has seen the Father, except the One being from God, He has seen the Father.
Joh 6:47 Truly, truly, I say to you, The one believing into Me has everlasting life.
Joh 6:48 I am the Bread of life.
Joh 6:49 Your fathers ate the manna in the wilderness and died.
Joh 6:50 This is the Bread coming down out of Heaven, that anyone may eat of it and not die.
Joh 6:51 I am the Living Bread that came down from Heaven. If anyone eats of this Bread, he will live forever. And indeed the bread which I will give is My flesh, which I will give for the life of the world.
Joh 6:52 Then the Jews argued with one another, saying, How can this One give us his flesh to eat?
Joh 6:53 Then Jesus said to them, Truly, truly, I say to you, Except you eat the flesh of the Son of Man, and drink His blood, you do not have life in yourselves.
Joh 6:54 The one partaking of My flesh and drinking of My blood has everlasting life, and I will raise him up at the last day.
Joh 6:55 For My flesh is truly food, and My blood is truly drink.
Joh 6:56 The one partaking of My flesh and drinking of My blood abides in Me, and I in him.
Joh 6:57 Even as the living Father sent Me, and I live through the Father; also the one partaking Me, even that one will live through Me.
Joh 6:58 This is the Bread which came down out of Heaven, not as your fathers ate the manna and died; the one partaking of this Bread will live forever.
Joh 6:59 He said these things teaching in a synagogue in Capernaum.
Joh 6:60 Then many of His disciples having heard, they said, This Word is hard; who is able to hear it?
Joh 6:61 But knowing in Himself that His disciples were murmuring about this, Jesus said to them, Does this offend you?
Joh 6:62 Then what if you see the Son of Man going up where He was at first?
Joh 6:63 It is the Spirit that gives life. The flesh does not profit, nothing! The Words which I speak to you are spirit and are life.
Psa 34:8 Taste and see that YHWH is good; blessed is the man seeking refuge in Him.
Kepha (Peter) applies this verse in Tehillim (Psalms) speaking of YHWH to the Word.
1Pe 2:2 as newborn babes desire the pure soul-nourishing milk, that you may grow by it;
1Pe 2:3 if indeed you “tasted” “that the Lord is good;”
Aramaic
1Pe 2:2 And become like newborn babes, and long for the word, as for pure and spiritual milk, that you may grow to salvation by it:
1Pe 2:3 If so be you have tasted and found out that the LORD is good.
That which angels seek
1Pe 1:10 About which salvation the prophets sought out and searched out, prophesying concerning the grace for you,
1Pe 1:11 searching for what, or what sort of time the Spirit of Christ made clear within them; testifying beforehand of the sufferings belonging to Christ, and the glories after these.
1Pe 1:12 To whom it was revealed that not to themselves, but to us they ministered the same things, which now were announced to you by those having preached the gospel to you in the Holy Spirit sent from Heaven; into which things angels long* to look into
*G1937
ἐπιθυμέω
epithumeō
Thayer Definition:
1) to turn upon a thing
2) to have a desire for, long for, to desire
3) to lust after, covet
3a) of those who seek things forbidden (hidden)
What is the Hebrew word for hidden?

The word matza (unleavened bread) comes from the root word matza meaning something hidden or squeezed. Salvation (yeshua) is connected to matza (unleavened bread).
Unleavened Bread is a picture of Messiah. Matsa is pierced, bruised and striped which points back to Isaiah 53, where the Right Arm of YHWH is revealed. The Right Arm of YHWH = the Light of His Face (lechem paniym)
Psa 44:3 For they did not inherit the land with their own sword; yea, their own arm did not save them. But it was Your right hand and Your arm and the light of Your face, because You favored them.
As seen in part 1click here, part of the mark of YHWH is keeping the feast of Unleavened Bread.
Exo 13:6 Seven days thou shalt eat unleavened bread, and in the seventh day shall be a feast to the LORD.
Exo 13:7 Unleavened bread shall be eaten seven days; and there shall no leavened bread be seen with thee, neither shall there be leaven seen with thee in all thy quarters.
Exo 13:8 And thou shalt shew thy son in that day, saying, This is done because of that which the LORD did unto me when I came forth out of Egypt.
Exo 13:9 And it shall be for a sign unto thee upon thine hand, and for a memorial between thine eyes, that the LORD’S law may be in thy mouth: for with a strong hand hath the LORD brought thee out of Egypt.
Mar 8:15 And He charged them, saying, See! Beware of the leaven of the Pharisees, and of the leaven of Herod.
Leavened breadclick here = hypocrisy = being clothed in the filthy garments of man…ie the man of sin. Leaven also comes from the word:

This is what Paul refers to in his letter to the Corinthians (1 Corinthians 5:7) where he says to get rid of the leaven of wickedness. Paul used the word:
G4189
πονηρία
ponēria
Thayer Definition:
1) depravity, iniquity, wickedness
2) malice
3) evil purposes and desires
Webster’s dictionary
Wicked
WICKED, a. [The primary sense is to wind and turn, or to depart, to fall away.]
Here wickedness is connected with leavened bread that is twisted and turned in a kneading bowl.
A related word in Hebrew is:


Twisting of the Scriptures
2Pe 3:15 And think of the long-suffering of our Lord as salvation, as also our beloved brother Paul wrote to you, according to the wisdom given to him;
2Pe 3:16 as also in all his epistles, speaking in them concerning these things, in which are some things hard to understand, which the unlearned and unsettled pervert*, as also they do the rest of the Scriptures, to their own destruction.
*G4761
στρεβλόω
strebloō
Thayer Definition:
1) to twist, turn awry
This word is used in the LXX to translate the following Hebrew word:

This word comes from the root:


1Co 5:8 So let us keep the feast, not with old leaven, nor with leaven of malice* and of evil, but with unleavened bread of sincerity and truth.
G2549
κακία
kakia
Thayer Definition:
1) malignity, malice, ill-will, desire to injure
2) wickedness, depravity
2a) wickedness that is not ashamed to break laws
3) evil, trouble
This concept of wickedness being equated with lawlessness is seen in how the following verse in translated into the English.
2Th 2:8 And then “the Lawless One” will be revealed, “whom” “the Lord” “will consume” “by the spirit of His mouth,” and will bring to nought by the brightness of His presence. Isa. 11:4
Notice that the lawless one, the man of sin, is pictured by a twisted cord. This is another link to the changing of DNA being the mark of the beast.
Unleavened Bread & Passover are all about the blood of the lamb that brings salvation (John 1:36).
Exo 12:13 And the blood shall be a sign to you, on the houses where you are. And I will see the blood, and I will pass over you*. And the plague shall not be on you to destroy, when I strike in the land of Egypt.
*This is connected to the book of Ezekiel and the mark of the righteous
Eze 9:4 And YHWH said to him, Pass through in the midst of the city, in the midst of Jerusalem, and mark a mark on the foreheads of the men who are groaning and are mourning over all the abominations that are done in her midst.
Eze 9:5 And He said to those in my hearing, Pass over in the city after him and strike. Do not let your eye spare, and do not have pity.
It is the blood of Messiah that marks us as His own
Rev 1:5 even from Jesus Christ the Faithful Witness, the First-born out of the dead, and the Ruler of the kings of the earth. To Him loving us and washing us from our sins by His blood,
Rev 1:6 and made us kings and priests to God, even His Father. To Him is the glory and the might forever and ever. Amen.
What is the counterfeit? Salvation through bloodlinesclick here.
Table of Showbread (Lechem Paniym)
Jesus is His paniym (presence, face)
Psa 42:5 O my soul, why are you cast down and moan within me? Hope in God, for I shall yet thank Him for the salvation of His presence.

Psa 44:3 For they did not inherit the land with their own sword; yea, their own arm did not save them. But it was Your right hand (Messiah Exo 15) and Your arm (Messiah Isa 53) and the light of Your face, because You favored them.
Heb 1:3 who being the shining splendor of His glory, and the express image of His essence, and upholding all things by the Word of His power, having made purification of our sins through Himself, He sat down on the right of the Majesty on high, Psa. 110:1
The bread of the Presence sat upon a table. The Hebrew word for table is Shulchan. Coming from the root shalach meaning to send out. It is the word that is translated as Apostle.
Apostles take for the Bread of Life to the world
Isa 52:7 How beautiful on the mountains are the feet of him proclaiming good news, making peace heard, bearing tidings of good, making heard salvation (Heb. yeshua), saying to Zion, Your God reigns.
Joh 4:32 But He said to them, I have food to eat which you do not know.
Joh 4:33 Then the disciples said to one another, No one brought Him food to eat?
Joh 4:34 Jesus said to them, My food is that I should do the will of Him who sent Me, and that I may finish His work.
Joh 6:51 I am the Living Bread that came down from Heaven. If anyone eats of this Bread, he will live forever. And indeed the bread which I will give is My flesh, which I will give for the life of the world.
Bread=His flesh=Basar=Gospel

Man was made in the image of God (Genesis1:26)…Messiah is the Image of God (Hebrews 1:3; 2 Corinthians 4:4), hence when we look at the human body it points to Messiah. The body as a whole, and each individual body part speaks the Gospel.
The Gospel is connected w/flesh. Where is the first reference to flesh? The union of Adam and Eve…a picture of Jesus and His Bride becoming one the fulfillment of the Good News.
Gen 2:21 And YHWH God caused a deep sleep to fall on the man, and he slept. And He took one of his ribs, and closed up the flesh underneath.
Gen 2:22 And YHWH God formed the rib which He had taken from the man into a woman, and brought her to the man.
Gen 2:23 And the man said, This now at last is bone from my bones, and flesh from my flesh. For this shall be called Woman, because this has been taken out of man.
Gen 2:24 Therefore, a man shall leave his father and his mother, and shall cleave to his wife and they shall become one flesh
Eph 5:30 For we are members of His body, of His flesh, and of His bones.
Eph 5:31 “For this, a man shall leave his father and mother, and shall be joined to his wife, and the two shall be one flesh.” Gen. 2:24
Eph 5:32 The mystery is great, but I speak as to Christ and as to the assembly.
The word for bride is:

This comes from the root ‘kol’ which is related to the belly (chay-life):

The Hebrew word for food comes from this same root:

The English word cell comes from this Hebrew root. The human cell is designed just as the Tabernacle/Temple. DNA, in the nucleus of the cell is the blueprint for life & the flesh. It corresponds to the 10 commandments and the Torah in the Holy of Holies of the Tabernacle.

Cell -early 12c., “small room,” from L. cella “small room, store room, hut,” related to L. celare “to hide, conceal,” from PIE base *kel- “conceal”
This corresponds perfectly to the Temple/Tabernacle of God which was overlaid with gold.
Eze 7:22 I also will turn My face from them, and they shall defile My hidden place. And violent ones shall enter into it and defile it.
The Temple & the Body
In His Shadow/Image
Gen 1:26 And God said, let Us make man in Our image*, according to Our likeness; and let them rule over the fish of the sea, and over the birds of the heavens, and over the cattle, and over all the earth, and over all the creepers creeping on the earth.
Gen 1:27 And God created the man in His own image*; in the image* of God He created him. He created them male and female.
*H6754
צלם
tselem

Psa 61:4 I will dwell in Your tabernacle* forever; I will trust in the shelter of Your wings. Selah.
*The Tabernacle/His House = the abiding in His Wings
Zion = His habitation…Zion = His people (Isaiah 51:16)
Psa 132:13 For the LORD hath chosen Zion; he hath desired it for his habitation.
2Co 6:16 And what agreement hath the temple of God with idols? for ye are the temple of the living God; as God hath said, I will dwell in them, and walk in them; and I will be their God, and they shall be my people.
Omer
The manna in the wilderness was measured by omers
Exo 16:15 And the sons of Israel looked. And they said, each one to his brother, What is that? For they did not know what it was. And Moses said to them, That is the bread which YHWH has given to you for food.
Exo 16:16 This is the thing which YHWH commanded. Gather from it, each one according to the mouth of his eating; an omer for a head. By the number of your souls you shall take for each man who is in your tent.
Verse 16 contains all the letters of the Hebrew alphabet which further links manna to the Word.
Exo 16:14 And the layer of dew went up, and, behold, something small was on the face of the wilderness, scalelike, small like the hoarfrost on the earth.
The word for ‘hoarfrost’ in verse 14 is ‘kaphor’ which is also translated as ‘ransom’ in reference to money.

In Revelation it is spoken of a famine type situation where must pay a day’s wages in order to obtain food.
Rev 6:6 And I heard a voice in the midst of the four living creatures saying, A choenix of wheat for a denarius, and three choenixes of barley for a denarius; and do not harm the oil and the wine.
A choenix measures about one quart. Compare that with what an Omer measures (3.75 quarts) and it is seen that the woman in the wilderness spoken of in Revelation 12 is going to be satisfied.
As in most things pertaining to the Word, the adversary has a counterfeit.
Laurence Gardner describes this mfkzt as the Phoenix/Philosopher’s stone.

Lost Secrets of the Sacred Ark pg 120
Gardner states that the converts gold into mfkzt/Paradise Stone is through the high spin state of certain elements.
“When perfectly correlated, the electrons turn to pure white light and it becomes impossible for the individual atoms in the high-spin substance to hold together. On that account, they cannot retain the metallic state, and he substance falls apart to become a white monatomic powder.”

Lost Secrets of the Sacred Ark pg 122
“When a DNA state is altered, as in the case of a cancer, the application of a platinum compound will resonate with the deformed cell, causing the DNA to relax and become corrected.”
“Bristol-Myers Squib announced that ruthenium atoms interact with DNA, correcting the malformations in cancer cells. What the new science determined was that monatomic ruthenium resonates with the DNA, dismantles the short-length helix, and rebuilds it again correctly- just as on might demolish and resurrect a dilapidated building.”
Lost Secrets of the Sacred Ark pg 123-124
“Likewise, the monatomic powder of iridium has a similar effect on the serotonin production of the pituitary gland, and would appear to reactivate the body’s ‘junk DNA,’ along with underused parts of the brain.”
“Melatonin is manufactured by the pineal gland through an activated chemical messenger called serotonin…It [the pineal gland] is the body’s most potent and effective antioxidant, and it has positive mental and physical anti-ageing properties.”
Lost Secrets of the Sacred Ark pg 124
“They [the ancients] knew there were superconductors inherent in the human body; they were the elemtns of individual consciousness which they called the ‘light body’ (the Ka). They knew that both the physical body and the light body had to be fed to increas hormonal production, and the ultimate food for the latter was called shem-an-na. This was manufactured by the priestly Master Craftsmen of the temples (the guardians of the House of Gold) for the express purpose of deifying the kings.”
This is why images of Sumerian priest kings held wands with pine cones on top which represented the pineal gland.

These ‘genies’ carried with them receptacles ‘pollen’ from the Plant of Birth.
Lost Secrets of the Sacred Ark pg 125-126
“The Plant of Birth was a purely symbolic tree (like the Tree of Life) from which, in accordance with the Sumerian King List, the kings were said to have been fed. Its representation was directly concerned with the Mesopotamian Gra-al: the ‘nectar of supreme excellence’ called the Gold of the Gods which was a designation of the goddess Hathor in Egypt. By virtue of this, and given that the kings were fed with the highward fire-stone of the shem-an-na, it seems beyond doubt that the substance carried by the Genies was not pollen, but the mfkzt powder of gold.”
The Mesopotamian Graal is seen in the Holy Grail stories. This is interesting to note as the Knights Templars, who are the supposed finders of the Grail & the treasures hidden under the Temple, are known as the first ‘bankers.’
Guardians of the Grail pg 24
“…the Priory of Sion organized the Knights Templar to excavate the Temple site in hopes of finding the fabulous treasure of the Temple. Evidently they were successful, for they instituted an international banking system across Europe and had the resources to loan gold to kings and governments…The secret purpose for the Knights Templar, however, was to preserve the Merovingian bloodline in hopes of one day establishing a world government and putting their king upon the throne – a king who could claim to be the offspring of Jesus Christ and Mary Magdalene.”
Money Grows on the Tree of Knowledge – Tracy Twyman
tsion
“There is plenty of evidence that the Templars did practice Gnosticism, including a coin that has been found with the words “Templi Secreti” or “Secret of the Temple” written upon it. On one side there is an unmistakable depiction of the Gnostic deity Abraxas. He was viewed as the “Great Archon”, the union of good and evil, masculine and feminine. Like Baphomet, he is a chimera, with a hawk’s head, a man’s body, and serpents for legs. On the other side of the coin was a serpent with a lion’s head, a common Gnostic depiction of Ialdaboath.”


Nicholas Flamel called the ‘shem-an-na’ a ‘gift from Paradise’, the Philosopher’s stone.

White Powder Gold, Monatomic Gold
http://coupmedia.org/alchemy/white-powder-gold-monatomic-gold-0612
“The Chemistry and Physics of Monoatomic Elements, describes the characteristics of those elements which have come to be known as the “Precious Metals”. These eight metals include: ruthenium, rhodium, palladium, and silver (known as the “light platinum group”), osmium, iridium, platinum, and gold (known as the “heavy platinum group”).
These eight Transition Group elements, can in a monoatomic, superdeformed, high spin, and low energy state, lose their chemical reactivity and metallic nature — thereby resulting in a state of Superconductivity — a resonant condition complete with Meissner magnetic field(s), Cooper Pairs, and electrons which have literally changed into light (i.e. photons). These precious metals have the unique ability to remain stable in the monoatomic form, which can then lead to effects ranging from Levitation (weight losses) to Zero-Point Energy applications to fundamental biological and/or human physiological effects.
Of particular importance is the fact that all of these precious metals have a strong affinity for and are almost always found in their natural state in combination with gold. Gold, in turn, has a history of being the most precious of all commodities — a “spiritual tradition” which has survived countless generations!
For example, the second chapter of the Book of Genesis (King James version), describes the creation of the heavens and the earth, its population with plants, animals, and herbs, the creation and installation of man in the Garden of Eden, and the appearance from out of the ground of the Tree of Life and the Tree of Knowledge of Good and Evil. The Bible then quickly informs us that thar’s gold in them thar hills! “And the gold of that land is good; there is bdellium and the onyx stone.” [Genesis 2-12]
On the scale of creating heaven, earth, Eden, mankind, and so forth, why is gold suddenly such a priority? If the science of the ORME is correct, gold, along with Rhodium and Iridium (and potentially the other precious metals) may in fact be the Tree of Life. [Note that in this connection Genesis 2:5 – 2:25 is considered to be from an earlier source than Genesis 1:1 – 2:4, and thus may be alluding to a deeper meaning.]
Hudson has also connected the ORME {Orbitally Rearranged Monoatomic Element} with the Hebrew tradition of the Ma-Na or Manna — also thought to be the White Powder of Gold. Curiously, manna means literally: “What is it?” This phrase is found repeated over and over again in The Egyptian Book of the Dead, The Papyrus of Ani. The historical and philosophical implications thus include the ORME as part of the Melchizedek priesthood and the metallurgical foundry at Qumrun, where the Essenes were located.
Other references include the mixture of the white powder of gold in water as being “that which issues from the mouth of the creator”, “the semen of the father in heaven”, and The Golden Tear from the Eye of Horus. Hudson believes that Moses knew the secrets of making the ORME, and that the Ark of the Covenant was merely a container for the ORME. As a volatile, superconducting, electrical device, the ORME’s presence within would explain the incredible properties of the Ark; from levitation to “blasts of heavenly displeasure.” Later in the Essene tradition, the white powder of gold began being referred to as the “teacher of righteousness”, something which was swallowed and taken internally.
With respect to the Ark, Laurence Gardner ’s book, Lost Secrets of the Sacred Ark is a brilliant expositon about the “amazing revelations of the incredible power of gold”, and gold’s inimate association with the Ark of the Covenant. Combined with his earlier book, Genesis of the Grail Kings, a great deal of information can be obtained.
The astounding result of combining the theories of the Anunnaki and the ORME lead to the almost inescapable conclusion that the Anunnaki’s purpose on arriving on Earth was to acquire the monoatomic elements for the purpose of ingesting them and thus being able to lead long lives. It is noteworthy that the first attempt by the Anunnaki to obtain gold was extracting it from sea water, specifically the upper reaches of the Persian Gulf where the Tigris and Euphrates Rivers meet. According to Hudson, the primary form in which gold occurs in sea water is in its monoatomic state.”
Kabbalah connection:
Lost Secrets of the Sacred Ark pg 90
“According to Qabalistic doctrine, the whole mystery of the cherubim rests upon understanding the alchemical principles as described in the hermetic text of Job 28:5-6. This brings all that we have discussed (the fire, bread, stone, sapphire, and gold) together in one equation: ‘As for the earth, out of it cometh bread; and under it is turned up as it were fire. The stones of it are the place of sapphires; and it hath dust of gold’.”
Gene Gun
Wikipedia.org
“A gene gun or a biolistic particle delivery system, originally designed for plant transformation, is a device for injecting cells with genetic information. The payload is an elemental particle of a heavy metal coated with plasmid DNA. This technique is often simply referred to as bioballistics or biolistics.”
In short, the gene gun inserts gold into cells in order to manipulate the DNA and keep the cell from rejecting foreign DNA.
Gene guns have also been used to deliver ‘DNA vaccines’. More on this below…
“Power will gravitate into the hands of those who control information…a technotronic era, a dictatorship,… Finally, looking ahead to the end of the century, the possibility of biochemical mind control, and genetic tinkering with man, including beings which will function like men, and reason like them as well, could give rise to some difficult questions.” (Zbigniew Brzezinski – The Technotronic Era)
IBM Builds ‘Bar Code Reader’ for DNA
http://www.foxnews.com/scitech/2009/10/05/ibm-builds-bar-code-reader-dna/?test=latestnews
“The DNA Transistor is a project from IBM Research that aims to advance personalized medicine, by making it simpler (and much cheaper) to read an individual’s unique DNA sequence — the special combination of proteins that makes you unlike anyone else. The technology isn’t finished yet, but its potential is tantalizin enough that IBM wanted to share it with the world. And the company claims researchers are making progress. Essentially a bar code reader for genes, the DNA Transistor is part technique and part device. It consists of a 3-nanometer wide hole, known as a nanopore, in a silicon microchip. A sensor in the pore can read DNA and determine its unique makeup.”
2 Tables
Laurence Gardner attempts to show that the gold of the mystery religions is one and the same with the bread offered by Melchizedek and then Jesus as a symbol of His Body & the New Covenant. This is a perfect picture of the mark of the beast. A counterfeit of the Truth and an attempt to change the Word to fit the schemes of the adversary..‘Yea, hath God said.’ We must choose between the Table of YHWH or the table of the adversary (Mammon).
Interestingly, in Isaiah we read of a Table prepared for Meni which in Hebrew means a number (as in number of the beast.)
Number – Meni
Isa 65:11 But you are those who forsake YHWH, who forget My holy mountain; who array a table for Fortune, and who fill mixed wine for Fate (Hebrew – meni).
H4507
מני
menı̂y
BDB Definition:
Meni = “fate” or “fortune”
1) god of fate who the Jews worshipped in Babylonia
Part of Speech: noun proper masculine
A Related Word by BDB/Strong’s Number: from H4487
H4487
מנה
mânâh
BDB Definition:
1) to count, reckon, number, assign, tell, appoint, prepare
1a) (Qal)
1a1) to count, number
1a2) reckon, assign, appoint
1b) (Niphal)
1b1) to be counted, be numbered
1b2) to be reckoned, be assigned
1c) (Piel) to appoint, ordain
1d) (Pual) appointed (participle)
Part of Speech: verb
A Related Word by BDB/Strong’s Number: a primitive root
Same Word by TWOT Number: 1213
Manah comes from the Hebrew root word מן ‘man’ which refers back to a seed, the blood (DNA) a type or kind. A tree only brings forth fruit from the seed which is within itself (Genesis 1:12). A good tree can’t bring forth corrupt fruit and a corrupt tree can’t bring forth good fruit (Matthew 7:18).

Notice that the word ‘manna’ comes from this same word. The word for likeness, ‘temunah’, also comes from this root for the above reasons. The image of the beast comes forth from the tree of knowledge, its kind (man). The Image of YHWH comes forth from the Tree of Life, His kind (man).
Preparing a table for Meni links to Paul’s warning that we cannot partake of the table of God & the table of the adversary.
1Co 10:20 But the things the nations sacrifice, “they sacrifice to demons, and not to God.” Deut. 32:17 But I do not want you to become sharers of demons;
1Co 10:21 you cannot drink the cup of the Lord and a cup of demons; you cannot partake of the table of the Lord, and a table of demons.
This chapter has fascinating connections to the above mentioned information on gold.
1Co 10:6 But these things became examples for us, so that we may not be lusters after evil, even as those indeed lusted.
1Co 10:7 Neither be idolaters, even as some of them, as it has been written, “The people sat down to eat and drink, and stood up to play.” Ex. 32:6
This is a reference back to the golden calf which is linked to monatomic gold, as seen above. Paul then goes on to speak of the bread that we partake which is the Body of Messiah. This speaks of the New Covenant meal at the Table of God. This is the manna that was sent down from heaven and corresponds to the Tree of Life. The table of demons is where Meni is worshipped, where the false manna/mfkzt is eaten which corresponds to the tree of knowledge.
1Co 10:11 And all these things happened to those as examples, and it was written for our warning, on whom the ends of the ages have come.
1Co 10:12 So that he that thinks to stand, let him be careful that he not fall.
1Co 10:13 No temptation has taken you except what is human; but God is faithful, who will not allow you to be tempted above what you are able. But with the temptation, He will also make the way out, so that you may be able to bear it.
1Co 10:14 On account of this, flee from idolatry, my beloved.
1Co 10:15 I speak as to prudent ones; you judge what I say.
1Co 10:16 The cup of blessing that we bless, is it not a partaking of the blood of Christ? The bread which we break, is it not a partaking of the body of Christ?
1Co 10:17 Because we, the many, are one bread, one body, for we all partake of the one bread.
1Co 10:18 Look at Israel according to flesh; are not those eating the sacrifices partakers of the altar?
1Co 10:19 What then do I say, that an idol is anything, or that an idolatrous sacrifice is anything?
1Co 10:20 But the things the nations sacrifice, “they sacrifice to demons, and not to God.” Deut. 32:17 But I do not want you to become sharers of demons;
Mammon
Luk 16:13 No servant is able to serve two lords; for either he will hate the one, and he will love the other; or he will cling to one, and he will despise the other. You are unable to serve God and mammon.
Luk 16:14 And being lovers of money, the Pharisees also heard all these things; and they derided Him.
Luk 16:15 And He said to them, You are those justifying yourselves before men, but God knows your hearts; for the thing highly prized among men is a hateful thing before God.
Mat 6:19 Do not treasure up for you treasures on the earth, where moth and rust cause to perish, and where thieves dig through and steal.
Mat 6:20 But treasure up for you treasures in Heaven, where neither moth nor rust cause to perish, and where thieves do not dig through and steal.
Mat 6:21 For where your treasure is, there your heart will be also.
Mat 6:22 The lamp of the body is the eye. Then if your eye is sound, all your body is light.
Mat 6:23 But if your eye is evil, all your body is dark. If, then, the light in you is darkness, how great is the darkness!
Mat 6:24 No one is able to serve two lords; for either he will hate the one, and he will love the other; or he will cleave to the one, and he will despise the other. You are not able to serve God and wealth.
Bloodlines of the Illuminati pg 116
“THE ROTHSCHILDS AS “PROPHETS”
One item stands out as a person listens to the International Bankers and reads their books. They believe money is what makes the world go round. If you have money, you can do anything. Money is “God”, and it is worshipped and served. Even after these families accumulate more than can be spent, these devotees continue selling their souls for this false but powerful god. The great poet-philosopher Heinrich Heine (a Banker’s son) said, “Money is the god of our time, and Rothschild is his prophet.”
Much of the Protocols of Sion is about economics and money and how it is used to bring about the plans of the Elite.
Protocol 22
“IN OUR HANDS IS THE GREATEST POWER OF OUR DAY – GOLD: IN TWO DAYS WE CAN PROCURE FROM OUR STOREHOUSES ANY QUANTITY WE MAY PLEASE…Surely there is no need to seek further proof that our rule is predestined by God?
Surely we shall not fail with such wealth to prove that all that evil which for so many centuries we have had to commit has served at the end of ends the cause of true wellbeing – the bringing of everything into order? Though it be even by the exercise of some violence, yet all the same it will be established. We shall contrive to prove that we are benefactors who have restored to the rent and mangled earth the true good and also freedom of the person, and therewith we shall enable it to be enjoyed in
peace and quiet, with proper dignity of relations, on the condition, of course, of strict observance of the laws established by us.”
The handwriting on the wall which was revealed to Belshazzar as he drank from the vessels of the Temple at his table (of demons) further links Meni to money.
Dan 5:1 Belshazzar the king made a great feast to a thousand of his nobles. And he drank wine before the thousand.
Dan 5:2 When tasting the wine, Belshazzar commanded the golden and silver vessels brought, those his father Nebuchadnezzar had taken out of the temple in Jerusalem, that the king and his nobles, his wives, and his concubines might drink with them.
Dan 5:3 Then they brought the golden vessels that were taken out of the temple of the house of God in Jerusalem. And the king, his nobles, his wives, and his concubines drank with them.
Dan 5:4 They drank wine and praised the gods of gold, and of silver, and of bronze, of iron, wood, and stone.
Dan 5:5 At that moment fingers of a man’s hand came out and wrote on the plaster of the wall of the king’s palace across from the lampstand. And the king saw the part of the hand that wrote.
Dan 5:25 And this is the writing that was written: A MINA, A MINA, A SHEKEL, AND HALF MINAS.
Dan 5:26 This is the meaning of the thing: A MINA: God has numbered your kingdom and finished it.
Dan 5:27 A SHEKEL: You are weighed in the balances and found lacking.
Dan 5:28 HALF MINAS: Your kingdom is divided and given to the Medes and Persians.
Temple at the Center of Time – David Flynn pg 42
“MENE MENE TEKEL UPARSIN, were actually monetary values. These are described as the standards of weight for use in Ezekiel’s future temple in Jerusalem {Ezekiel 45:12}: ‘And the shekel (TEKEL) shall be twenty gerahs: twenty shekels, five and twenty shekels, fifteen shekels, shall be your maneh (MINAH).’ The numeric quantity represented were units of ancient Chaldean weights and measures.
The gerah was the smallest proportion of weight used in Babylonian commerce at the time. Mene (1,000 gerahs), Mene (1,000 gerahs, Tekel (20 gerahs), and Peres, to divide the Mene (500 gerahs) equals 2,520.”
This then also links money back to the temple. Notice that money (buying and selling) keeps linking to the Temple.
Money Changers
Joh 2:14 And He found those selling oxen and sheep and doves in the temple, and the money changers (kermatistēs) sitting.
Joh 2:15 And making a whip out of ropes, He threw all out of the temple, both the sheep, and the oxen, and the money changers, pouring out the money and overturning the tables.
Joh 2:16 And to the ones selling the doves, He said, Take these things from here! Do not make My Father’s house a house of merchandise.
Joh 2:17 And His disciples remembered that it was written, “The zeal of Your house has consumed Me.” Psa. 69:9
G2773
κερματιστής
kermatistēs
Thayer Definition:
1) a money changer, money broker
Part of Speech: noun masculine
A Related Word by Thayer’s/Strong’s Number: from a derivative of G2772
Kermatistes comes from kerma which comes from the root keiro which means to shear sheep.
G2772
κέρμα
kerma
Thayer Definition:
1) small pieces of money, small coin, change, money
Part of Speech: noun neuter
A Related Word by Thayer’s/Strong’s Number: from G2751
G2751
κείρω
keirō
Thayer Definition:
1) to sheer: a sheep
2) to get or let be shorn
3) of shearing or cutting short the hair of the head
Part of Speech: verb
A Related Word by Thayer’s/Strong’s Number: a primary verb
This word would trace back to the Hebrew word ‘geza.’

In connection with the current study, this word ‘geza’ is used for the concept of race.
Biblically, race is not defined by color or bloodlines. Race is defined by what nature you are. You are either in Messiah or you are not (Romans 8:9). You are either for Him or against Him (Luke 11:23). You are either the seed of the woman or the seed of the serpent. The word for color in Hebrew, צבע, has the same meaning as being baptised and becoming anew. You are either sprinkled by the blood of Messiah (Isaiah 52:15; Hebrew 10:22) or you are still covered in the garments of sinful flesh. Interestingly, one of the words for money in Hebrew (Exodus 21:30) is ‘kopher’ which has the meaning of atonement/covering.
Those who are of the ‘race’ of Messiah are those who abide in Him, the Olive tree.
1Pe 2:9 But you are “an elect race,” “a royal priesthood,” “a holy nation,” “a people for possession,” so that “you may openly speak of the virtues” of the One who has called you out of darkness into His marvelous light; LXX-Ex. 23:22; MT-Ex. 19:5, 6
In Hebrew the word for race is גזע, which means the stock/root of a tree.
H1503
גּזע
geza‛
BDB Definition:
1) stem, trunk, stock (of trees)
Who is the root of Israel? Messiah Jesus
Rom 11:16 For if the firstfruit (1Cor 15:52 -Messiah) be holy, the lump is also holy: and if the root (Isa 6:13; Gal 3:16 – Messiah) be holy, so are the branches (Joh 15:5).
Isa 11:1 And there shall come forth a rod out of the stem (H1503 גּזע geza‛)of Jesse, and a Branch{H5342 נצר netser*} shall grow (parah -bear fruit) out of his roots:
The other root spoken of in Scripture is the root of the serpent
Isa 14:29 Do not rejoice, O Philistia, all of you, for the rod of your striking is broken, because a viper comes forth from the root of a snake, and his fruit shall be a fiery flying serpent.
Notice that from the root of a snake comes for the fruit of a serpent. Above, from the root of Jesse comes forth the fruit of the Spirit. This is the true meaning of race. The seed of the woman or the seed of the serpent. Ye shall know them by their fruits.
Mat 7:14 For narrow is the gate, and constricted is the way that leads away into life, and few are the ones finding it.
Mat 7:15 But beware of the false prophets who come to you in sheep’s clothing, but inside they are plundering wolves.
Mat 7:16 From their fruits you shall know them. Do they gather grapes from thorns, or figs from thistles?
Mat 7:17 So every good tree produces good fruits, but the corrupt tree produces evil fruits.
Mat 7:18 A good tree cannot produce evil fruits, nor a corrupt tree produce good fruits.
Mat 7:19 Every tree not producing good fruit is cut down and is thrown into fire.
Mat 7:20 Then surely from their fruits you shall know them.
Mat 7:21 Not everyone who says to Me, Lord, Lord, will enter into the kingdom of Heaven, but the ones who do the will of My Father in Heaven.
Mat 7:22 Many will say to Me in that day, Lord, Lord, did we not prophesy in Your name, and in Your name cast out demons, and in Your name do many works of power?
Mat 7:23 And then I will declare to them, I never knew you; “depart from Me, those working lawlessness!” Psa. 6:8
Notice the link between sheep & fruit.
Back to the money changers
Mat 21:12 And Jesus entered into the temple of God and threw out all those selling and buying in the temple. And He overthrew the tables of the money changers (kollubistēs) and the seats of those selling the doves.
Mat 21:13 And He said to them, It has been written, “My house shall be called a house of prayer,” but you have “made it a den of plunderers.” Isa. 56:7; Jer. 7:11
G2855
κολλυβιστής
kollubistēs
Thayer Definition:
1) a money-changer, banker
Part of Speech: noun masculine
A Related Word by Thayer’s/Strong’s Number: from a presumed derivative of kollubos (a small coin – probably akin to G2854)
G2854
κολλούριον
kollourion
Thayer Definition:
1) a preparation composed of various materials and used as a remedy for tender eyelids
Part of Speech: noun neuter
A Related Word by Thayer’s/Strong’s Number: from a presumed derivative of kollura (a cake – prob akin to the base of G2853)
G2853
κολλάω
kollaō
Thayer Definition:
1) to glue, to glue together, cement, fasten together
2) to join or fasten firmly together
3) to join one’s self to, cleave to
Part of Speech: verb
A Related Word by Thayer’s/Strong’s Number: from kolla (“glue”)
This word ‘kolla’ is used to translate the Hebrew word ‘natsar’ in the Septuagint. Natsar is the word from whence ‘Christian’ comes. Again we see the two seeds, two tree, two tables…
Isa 11:1 And there shall come forth a rod out of the stem (H1503 גּזע geza‛)of Jesse, and a Branch{H5342 נצר netser*} shall grow (parah -bear fruit) out of his roots:
*Netser is the origin of the name ‘Christian’.Netsarim
Messiah’s assault on the moneychangers is linked to Jeremiah 7 & Isaiah 56. Isaiah 56 speaks of those who are considered ‘strangers’ cleaving to YHWH and are given a better place than literal descendants of Jacob. Jeremiah 7 speaks of those who are worshipping in the Temple of YHWH but at the same time worshipping Baal…ie mixed worship, the tree of knowledge.
Another link to the garden and money is the camel.
Mat 19:23 And Jesus said to His disciples, Truly I say to you that a rich man will with great difficulty enter into the kingdom of Heaven.
Mat 19:24 And again I say to you, It is easier for a camel to pass through a needle’s eye, than for a rich man to enter the kingdom of God.
As seen above in the section on the oroboros, in Kabbalalistic thought, the adversary in the garden was said to have been a camel.
The camel (gimel) is related to the golem in Rabbinic thought. The golem is a creature created from Kabbalistic magic, a perfect picture of the Image spoken of in Revelation 13. The deeper connection to the camel and the letter gimel is seen in Gnostic Kabbalistic thought.
http://gnosticteachings.org/courses/alphabet-of-kabbalah/03-gimel
“Gnosis gives the “gnana” of God: the Gimel (ג ), the letter G in the English alphabet.
The third letter of the sacred alphabet of Kabbalah is the letter Gimel. If you observe its shape, you see that it is made by a letter Vav (ו) and a letter Iod (י). This encloses the mystery of the sound “ggh,” which is guttural, meaning, in the throat. If you observe the Tree of Life you will see that – in the human being – the Sephirah Da’ath is precisely located at the level of the throat. This Sephirah Da’ath is Gnosis. Gnosis is written with g.
Gnosis is knowledge, which in Sanskrit is “gnana” with ‘g,’ yet sometimes they write this “Jnana.” In Hebrew, the letter Gimel has these two (ja and ga) sounds which are associated with many words.
The sound of gimel is located at the level of the throat.
This letter Iod – as you see in the letter gimel – is nothing but the letter Vav, which is an extended letter Iod. Vav or Zayin forms the straight line of the letter gimel, which indicates that the letter gimel extends from the letter Iod. Remember, the letter Iod represents the Sephirah Kether.
We explained in the letter Aleph that Kether is always represented by the letter Iod. Aleph is called the holy trinity, the unity formed by three Iods: Kether, Chokmah, and Binah. In Aleph we also find the symbol of the extended letter Iod expressed as Vav, which in the human organism is the spinal column, because the letter Vav represents the spinal medulla, the spinal column, which is the basis of our studies of Daath, Gnosis.
Remember that amongst the Father, Son, and Holy Spirit, the Holy Spirit is Binah, the third Sephirah in the Tree of Life. Binah is Hebrew for “intelligence, understanding.” It is pointing at the human being, which among all the animals is the one that has the capacity for understanding and intelligence. The intellectual animal is at the top of earthly evolution.
The letter gimel as the number three is represented by the mercury* of philosophy. Mercury is the Holy Spirit, which is an emanation of the holy tri-unity. This force always works in the central nervous system as El-Shaddai. Remember that it is stated that the central nervous system is the throne of God. That is why – in Christianity – those beings that are related with the Sephirah Binah at that level are called Thrones. It is because the throne of God is always made by the creative force of the Holy Spirit as El-Shaddai represented in the letter gimel.
Moreover, the Zohar also talks about a flying camel. If you associate the camel with gimel, it is easy to see that the energy of the Kundalini, the Holy Spirit, rises in the Vav, the spinal column, in the spine of the gimel, the gamal, the camel.
“When Samael tempted Adam to eat of the fruit of the tree of good and evil, he descended from heaven riding on this camel-like serpent at that time, all the creatures saw his image and fled from him.”
If you imagine that literally, you would see the master or Angel Samael riding a flying camel. But no, this is talking about the spinal column. The angel that rides in the spinal column is Samael Aun Weor.
‘Aun’ relates to the lower Iod of the letter gimel. ‘Aun’ is sexual strength in Hebrew. Weor means “and light” in Hebrew.
“And the life (of Aun, sexual strength) was the light (Aur / eor) of men (Gimel)”. {This is in reference to John 1:9 which speaks of Messiah…notice how this Kabbalistic author links Messiah with the serpent.}
“Weor”—”and the light”—rises in the Vav, the spinal column. Therefore, to ride in a camel (a Gimel) means to be somebody who has developed all the forces of the Kundalini, the Holy Spirit incarnated in the spinal column.”
*Remember that Mercury is associated with money, as mentioned above. This should be a strong warning for those who preach the prosperity gospel. {For more on the prosperity gospel and its connections to the markClick Here}
Notice that the Kabbalistic teaching on the letter gimel/camel is associated with the power of speech and links to money. Above, Messiah chastises the money changers and quotes a portion of Isaiah 56. It is interesting to note that the end of Isaiah chapter 56 speaks of pastors who are dumb dogs that are greedy and can never get enough wealth (Isaiah 56:10-12). It is significant to note that many of those who preach the prosperity gospel are a part of the ‘tongues’ movementClick Here which amazingly also is connected to the Kundalini Spirit.
Buying & Selling & the 4th Kingdom of Daniel
Dan 2:42 And as the toes of the feet were partly of iron and partly of clay, so the kingdom shall be partly (min qetsah) strong* and partly (min) fragile**.
The word translated as ‘partly’ in the above verse comes from the Hebrew ‘min.’ This word is a direct reference to DNA. Those of iron will have the DNA of the strong (taqaph) which means those in authority. As seen in the section on the satanic kingdom, this is referring to angelic beings (Ephesians 6:12). The clay will have the DNA of the fragile (shabar) which is a word which means to ‘buy or sell.’ Here it is seen that humans that mix with angels will be the same as those that are buying and selling. This further links the mark of the beast to the corruption of human DNA through the mixture of the seed.
Min – DNA

The next verse in Daniel 2 further illustrates this connection.
Dan 2:43 And as you saw the iron mixed with the clay of the clay, they shall be mixed with the seed of men. But they shall not adhere to one another, even as iron does not mix with clay.
The word for ‘mixed’ here is from the Hebrew ‘arav’ which also traces back to buying and selling.

Manly Hall links DNA (seed) with gold.
Secret Teachings of All Ages
“…in the sunlight or spiritual gold is concealed the first sperm of all life.”
Hall links this seed with the purpose of alchemy, the Philosopher’s Stone.
“When the alchemists stated that every animate and inanimate thing in the universe contained the seeds of gold, they meant that even the grains of sand possessed a spiritual nature, for gold was the spirit of all things…The purpose of alchemy was not to make something out of nothing but rather to fertilize and nurture the seed which was already present. Its processes did nor actually create gold but rather made the everpresent seed of gold grow and flourish. Everything which exists has a spirit–the seed of Divinity within itself–and regeneration is not the process of attempting to place something where it previously had not
existed. Regeneration actually means the unfoldment of the omnipresent Divinity in man, that this Divinity may shine forth as a sun and illumine all with whom it comes in contact.”
Manly Hall reveals that this golden seed/philosopher’s stone is represented by the hexagram. “Dr. Sigismund Bacstrom believed that if a physician could establish harmony among the elements of
earth, fire, air, and water, and unite them into a stone (the Philosopher’s Stone) symbolized by the sixpointed star or two interlaced triangles, he would possess the means of healing all disease.”
Back to the word ‘arav.’
On a deeper level, the word ‘arav’ is translated as ‘woof’, which is the mixing of cords when weaving. This links the buying and selling back to the Garden as Adam and Eve realized they were naked after eating from the tree of knowledge and made themselves aprons/girdles to wear.

‘Arav’ also has an interesting connection to the plagues in Exodus. ‘Arov’ is generally translated as flies but in reality means swarms.
Psa 78:45 He sent swarms of flies against them, and they devoured them; also frogs, and they destroyed them.
The Psalmist defines these swarms as ‘angels of evil.’
Psa 78:49 He sent the heat of His anger on them, fury and indignation and distress, a sending of angels of evils.
It is interesting to note that the Nephilim are linked to money & taxes in Scripture.
The phrase man/men of stature refers to the giants/nephilim in the Scriptures. The word is ‘ish/anashim middah’ in the Hebrew. The word middah means a measurement. It is connected to the measurement of the Tabernacle, Nephilim, tax and tribute as well as the measurement of the Temple in Zechariah 2 and Ezekiel 40 c&c.
Num 13:33 And we saw the giants there, the sons of Anak, of the giants. And we were in our own eyes as grasshoppers, and so we were in their eyes.
Num 13:32 And they sent out an evil report of the land which they had spied out to the sons of Israel, saying, The land into which we passed, to spy it out, is a land eating up the ones living in it. And all the people we saw in its midst were men of stature (middah)

2 tables, 2 species?
Human race will ‘split into two different species’
By NIALL FIRTH 26th October 2007
“The human race will one day split into two separate species, an attractive, intelligent ruling elite and an underclass of dim-witted, ugly goblin-like creatures, according to a top scientist.
100,000 years into the future, sexual selection could mean that two distinct breeds of human will have developed.
The alarming prediction comes from evolutionary theorist Oliver Curry from the London School of Economics, who says that the human race will have reached its physical peak by the year 3000.
The report claims that after they reach their peak around the year 3000 humans will begin to regress
These humans will be between 6ft and 7ft tall and they will live up to 120 years.
Dr Curry’s theory may strike a chord with readers who have read H G Wells’ classic novel The Time Machine, in particular his descriptions of the Eloi and the Morlock races.
In the 1895 book, the human race has evolved into two distinct species, the highly intelligent and wealthy Eloi and the frightening, animalistic Morlock who are destined to work underground to keep the Eloi happy.”
Genetic manipulation to give “eternal” life
DNA Breakthrough Could Give Humans Lifespans Lasting Hundreds of Years
Steve Connor
London Independent
Sunday February 3, 2008
“A genetically engineered organism that lives 10 times longer than normal has been created by scientists in California. It is the greatest extension of longevity yet achieved by researchers investigating the scientific nature of ageing.
If this work could ever be translated into humans, it would mean that we might one day see people living for 800 years. But is this ever going to be a realistic possibility?
Valter Longo is one of the small but influential group of specialists in this area who believes that an 800-year life isn’t just possible, it is inevitable. It was his work at the University of Southern California that led to the creation of a strain of yeast fungus that can live for 10 weeks or more, instead of dying at its usual maximum age of just one week.
By deleting two genes within the yeast’s genome and putting it on a calorie-restricted diet, Longo was able to extend tenfold the lifespan of the same common yeast cells used by bakers and brewers. The study is published later this week in the journal Public Library of Science Genetics.
There is, of course, a huge difference between yeast cells and people, but that hasn’t stopped Longo and his colleagues suggesting that the work is directly relevant to human ageing and longevity. “We’re setting the foundation for reprogramming healthy life. If we can find out how the longevity mechanism works, it can be applied to every cell in every living organism,” Longo says.
“We’re very, very far from making a person live to 800 years of age. I don’t think it’s going to be very complicated to get to 120 and remain healthy, but at a certain point I think it will be possible to get people to live to 800. I don’t think there is an upper limit to the life of any organism.”
In 2000, Stephen Hawking, spoke at the “Millenium Evening” at the White House and said that it was time for humanity to take charge of evolution, and to plan a program of systematic self-improvement of the species.
“You may know that I am suffering from what is known as Amyotrophic Lateral Sclerosis (ALS), or Lou Gehrig’s Disease, which is thought to have a genetic component to its origin. It is for this reason that I am a supporter of the $10M Archon X PRIZE for Genomics to drive rapid human genome sequencing. This prize and the resulting technology can help bring about an era of personalized medicine. It is my sincere hope that the Archon X PRIZE for Genomics can help drive breakthroughs in diseases like ALS at the same time that future X PRIZEs for space travel help humanity to become a galactic species.”
Why the name Archon? Archon comes from the Greek word ἄρχω ‘archo’ which is where the word archangel comes from. Coincidence?
As seen above, buying & selling is linked on a deeper level to DNA. In Revelation 13:17 it is said that no man may be able to buy or sell without the mark of the beast. How will this be implemented? Modern scientific devices may be leading the way to making this a reality.
Homeland Security Considering Portable, Instant DNA Scanners
By Mickey McCarter
Published March 04, 2011
| FoxNews.com
“A portable, breadbox-sized scanner could map out your body’s DNA in less than an hour — and the Feds want it added to the agency’s tool bag.
The device is being studied in the research-and-development wing of the Department of Homeland Security, which provided a special small-business contract to Network Biosystems (or NetBio) to build it. The agency will use the scanner at first on asylum seekers and refugees — but civil liberties guardians warned that the device has explosive potential for misuse.
“If it were used for routine criminal investigations, it would raise the specter of a national DNA database,” Verdi told FoxNews.com. “There are a lot of legal and constitutional hurdles that would have to be overcome for it to be lawfully used.”
To Protect Patented Genes, DARPA Wants a Security System that Records Genomic Changes By Clay Dillow
http://www.popsci.com/technology/article/2011-03/protect-patented-genes-darpa-wants-security-system-records-genomic-changes
“DARPA wants a genetic security system that’s built into the genome that can monitor for and report on changes to an organism’s genetic makeup.”
“DARPA wants a “track changes” feature for genomes like the one that tracks edits in a Word document, a technology that will record and report any modification to a genome. They call it Chronicle of Lineage Indicative of Origins, or CLIO.”
‘Track Changes’ for Your Genes: Darpa Goal
http://www.wired.com/dangerroom/2011/03/track-changes-for-your-genes-darpa-goal/
“Check out Darpa’s latest bright idea: to fund “multidisciplinary research proposals in the area of genomic and proteomic technologies that can continuously and persistently record specific natural or human promulgated environmental, physical and genomic events within the genetic or epigenetic systems of microorganisms.”
Fallen Angels/Annunaki
In ancient pagan cultures, there are stories of gods that came to earth and manipulated the genes of man to form Adam. This is a perversion of Genesis where God created man from the dust. These stories trace back to the fallen angels who came to earth and deceived mankind into worshipping them (the creation, not the Creator).
Rom 1:20 For the unseen things of Him from the creation of the world are clearly seen, being understood by the things made, both His eternal power and Godhead, for them to be without excuse.
Rom 1:21 Because knowing God, they did not glorify Him as God, nor were thankful. But they became vain in their reasonings, and their undiscerning heart was darkened.
Rom 1:22 Professing to be wise, they became foolish
Rom 1:23 and changed the glory of the incorruptible God into a likeness of an image of corruptible man, and of birds, and four-footed animals, and creeping things.
Rom 1:24 Because of this, God gave them up to impurity in the lusts of their hearts, their bodies to be dishonored among themselves,
Rom 1:25 who changed the truth of God into the lie, and worshiped and served the created thing more than the Creator, who is blessed forever. Amen.
Jesus said that as it was in the days of Noah, so shall it be in the end of days (Matthew 24:37). It is not impossible to imagine that fallen angels will come to earth in the time before the return of the Messiah, with a lie that they are going to help us “evolve” into the next step in the evolutionary ladder…ie the age of Aquarius. Even the leading evolutionist/atheist Richard Dawkins have stated that he believes that beings with superior intelligence may have come to earth to create man through manipulation of DNAclick here. Francis S. Collins, one of the country’s leading geneticists and longtime head of the Human Genome project believes that God created the universe and man is an evolution of chimpanzees on the “evolutionary tree of life” via changes in the letter sequence of DNA through millions of years of mutations. Collins is a believer in “theistic evolution” that professes that God created the universe but that he did not create life as Genesis statesclick here.
The Sumerians in their writings speak of the Annunaki. Those who “from heaven to earth came”. In these myths, it is said that the Annunaki created man as a slave race to serve them through manipulated the DNA of what we would call today ‘cro magnum man’ or some such creature. They divided the land and ruled over mankind.
It is said they came to earth on a planet known as Nibiruclick here. These myths of the Annunaki line up with Genesis 6 and therefore are relevant today as Messiah said the end of the age will be as in the days of Noahclick here. The coming of ‘Planet X’/’Nibiru’ and the ‘Annunaki’/’aliens’ is linked together in Revelation 8-9click here.
Uriels Machine pg 11
“The Sumerians believed that they came into the country with their civilization already formed…”
The exact same thing can be said of the Egyptians and Central Americans mentioned above.
Uriel’s Machine pg 137
“According to the ancient Egyptians, Zep Tepi had been an age when gods had ruled in their country, bringing the gift of civilization. The Egyptians believed that there had been intermediaries between gods and men whom they called the Urshu, which translates as the Watchers.”
“We have discussed these Egyptian Watchers with Graham Hancock, the well-known researcher and author, who has said:
‘…they [the Ancient Egyptians] preserved particularly vivid recollections of the gods themselves, puissant and beautiful beings called the Neteru who lived on earth with humankind and exercised their sovereignty from Heliopolis and other sanctuaries up and down the Nile. Some of these Neteru were male and some female but all possessed a range of supernatural powers which included the ability to appear, at will, as men or women, or as animals, birds, reptiles, trees or plants…”
DNA & ‘ alien creators’
“Aliens” (Fallen Angels) may teach they are the creators of man. Annunaki said they genetically engineered cro-magnum man to create a slave race “adam” in clay jars. This lines up with the ‘science’ of today and the theory of evolution.
In Genesis 1 it says ‘Let Us make man in Our Image’. This can be twisted and manipulated to mean angels/annunaki created man in their image. God can refer to angels as it is seen Paul’s interpretation of Psalm 8:5 in Hebrews 1:6 and could be used when the fallen angels return to earth to ‘recreate’ mankind or to help them to ‘evolve’ in their next step of evolution.
Gen 1:26 And God said, let Us make man in Our image, according to Our likeness; and let them rule over the fish of the sea, and over the birds of the heavens, and over the cattle, and over all the earth, and over all the creepers creeping on the earth.
Gen 1:27 And God created the man in His own image; in the image of God He created him. He created them male and female.
Is this why YHWH spoke through Jeremiah saying the following:?
Jer 10:11 So you shall say to them, The gods who have not made the heavens and the earth, they shall perish from the earth and from under these heavens.
Interestingly, Jeremiah 10 is the chapter talking about the idols which can be traced back to the tree of knowledge of good and evil which the heathen religion consideres the tree of life. The tree of life is supposedly a symbol for DNA. The pagan tree is then a symbol of the “god-man.” This is why the tree was used as a symbol for the heathen.
Cosmic Code – Zecharia Sitchin pg 171
“One of the rare (discovered) instances where the number ’6′ was revealed as a divine rank was in a tablet that was put together by Alasdair Livingstone in Mystical and Mythological Explanatory Works of Assyrian and Babylonian Scholars. The reconstructed tablet-which bears the admonition regarding the undisclosable secrets it contains-begins with 60 as the rank of the ‘preeminent god, father of the gods’ and then, in a separate column, reveals his identity: Anu. Followed by Englih (50), Ea/Enki (40), Sin (30) and Shamash (20), it lists Adad, the ‘god of rain and thunders,’ as ’6.’ As the listing continues on the obverse as well as the reverse sides, it lists ’600′ as the secret number of the Annunaki.
What emerges from the Meopotamian tablet regarding the secret numbers of the gods may well have the key to finally solving the mystery of ’666′ by looking at it as a Sumerian-based encoding:
600 = The Annunaki, ‘Those Who From Heaven to Earth Came.’
60 = Anu, their supreme ruler
6 = Adad, one of the gods who teaches Initiates
______
666 = ‘Here is Wisdom, ‘ ‘ Counted by him who has understanding’ “
Cosmic Code – Zecharia Sitchin pg 172
“While attention has been focused on the meaning of ’666,’ we find in the cryptic verse in Revelation a statement of utmost significance. The secret code, it states, is what Wisdom is all about, and it can be deciphered only by those who have Understanding.
These are precisely the two terms used byt the Sumerians, and those who came after them, to denote the secret knowlege that only privileged initiates had been taught by the Annunaki.”
Saturn – Anu – Sirius connection
Children of the Matrix pg 33
“A focus on Sirius can be found at the heart of most ancient societies – and secret societies.”
Sirius Mystery pg 96
“The Sumerian heaven-god is called Anu…Anu is represented by the jackal. Well, of course, the jackal is the symbol (interchangeable with the dog) of the Egyptian Anpu (Anubis)!…Anu is king of some attendant deities called the Anunnaki.”
Sirius Mystery pg 98
“Others again are of the opinion that by Anubis is meant Time, and that his denomination of Kuon [the Greek word for the ‘dog’] does not so much allude to any likeness which he has to the dog, though this be the general rendering of the word, as to that other significance of the term taken from breeding; because Time begets all things out of itself, bearing them within itself, as it were in a womb. But this is one of those secret doctrines which are more fully made known to those who are initiated into the worship of Anubis.”
Sirius Mystery pg 99
“Plutarch says: ‘Some are of the opinion that Anubis is Chronos.’ Chronos, of course, was the Greek ‘time the devourer’, spelt with an h. Cronos in Latin is Saturn.

The above picture is of the Sumerian ‘god’ Ninurta. Ninurta = Saturn.
Saturn (סתור = 666 )
In Genesis 1 it says ‘Let Us make man in Our Image’. This can be twisted and manipulated to mean angels/annunaki created man in their image. God can refer to angels as it is seen Paul’s interpretation of Psalm 8:5 in Hebrews 1:6 and could be used when the fallen angels return to earth to ‘recreate’ mankind or to help them to ‘evolve’ in their next step of evolution.
Triple Helix
Triple-stranded DNA was a common hypothesis in the 1950s when scientists were struggling to discover DNA’s true structural from. Watson and Crick (who later won the Nobel Prize for their double-helix model) originally considered a triple-helix model, as did Pauling and Corey who published a proposal for their triple-helix model in the 1953 scientific journal Nature, as well as fellow scientist Fraser. However, Watson and Crick soon identified several problems with these models: 1) Negatively charged phosphates near the axis will repel each other, leaving the question as to how the three-chain structure would stay together. 2) In a triple-helix model (specifically Pauling and Corey’s model), some of the van der Waals distances appear to be too small.
DNA Interactive
Linus Pauling Triple Helix model
“Problem with Pauling’s model is that ‘Phosphates form helical cord with the bases pointing outward this would be impossible under normal cellular conditions. Each phosphate group is negatively charged and so many negative charges forced together would repel each other, literally driving the structure apart.”
Dan 2:43 And as you saw the iron mixed with the clay of the clay, they shall be mixed with the seed of men. But they shall not adhere to one another, even as iron does not mix with clay.
New DNA, New Consciousness, New Intelligence: channeled information from Adama, channeled by Princess Sharula Dux.
“For those who embrace the change and the newness, they are coming into a new way of being. The third strand of DNA developing in your body makes you a Christ. A living, holy trinity. In realizing yourself as the living trinity you will move beyond duality. The new amino acids will make it easier for your brain to fire off the new codes.”
Trident
The trident has been mentioned multiple times in this series of studies. It is linked to transformation and the ‘tree of life’ and perhaps even 3 strand DNA.
http://firstlegend.info/thetreeoflife.html
Kingship, Inanna and the Tree of Life
“When the kingship was lowered from heaven, the kingship was in Eridu” so says the Sumerian King List. This is the root of divine rule. Mesopotamian kings displayed their divine inheritance through symbols the most telling being the branch from the Tree of Life. It all begins with Inanna. There is no doubt of Inanna’s connection to the Tree of Life. To the far left she is shown holding a branch from the Tree of Life. This may be the origin of the scepter. In the Sumerian tale of Inanna and Enki Inanna travels to Eridu and visits with Enki. During her stay they drink beer together and during this time Enki gives her the mes which in this case includes the throne of kingship and kingship itself. It became tradition that the king be ritually married to Inanna and earn his divine right to rule. Thus we have the trapping of power derived from Inanna in the symbolism of the Tree of Life. Below are some examples of this symbolism.
“The above image shows Enki associated with four rivers. So how does all this relate to the “mark of Eden”? According to Sumerian mythology Enki is the source of all sweet water (as opposed to salt water). The water flows from Enki and in some images of Enki he is shown with four rivers flowing from him. He lives in the Abzu the source of his sweet waters. His temple is beneath the world tree. Genesis states water flowed from Eden into four rivers. The world tree is the axis mundi located at the center of a terrestrial “X”. Four rivers therefore issue from the axis mundi which houses Enki’s palace in the Abzu. The Sumerians pictured the world as a flat disk which was encircled by fresh water. This is the cross in a circle. The circle represents the Sumerian known world. The “X” represents both the location of the Axis Mundi at the center of the world as well as the four rivers from which all sweet waters originate. The Axis Mundi, the world tree, represents the Tree of Life that grew at the center of the Garden of Eden.”
The below drawing (1928) from a cylinder seal of King Gudea of Lagash, ca. 2100 B.C. shows Ningishzida as a human with serpent-dragon heads erupting from shoulders and as a fourlegged beast with horns and wings .
Ningishzida is interpreted as Lord or lady of the ‘good tree.’ This connection between a lady and a lord is discussed in more detail in part 9click here where it is discussed in more detail how Lucifer is sometimes portrayed as a female. The connection between Ningishzida and the serpent is further seen in the following quote.
“…Ningishzida, who brings together giant snakes and dragons!…who directs speech aright, and who hates wickedness! Mighty power, whom no one dare stops when he spreads confusion!…The merciful king [Enki] entrusted you from your birth…He let you have life and creation…Who can rival you in the highest heaven?…you who carry out commands in the great Underworld…” (A balbale to Ningishzida.” Jeremy Black, Graham Cunningham, Eleanor Robson & Gabor Zolyomi. The Literature of Ancient Sumer pg 250-252).
Joseph Campbell in his book ‘the Masks of God: Occidental Mythology pg 9 also speaks of Ningishzida as the serpent of the garden of Eden. He interprets his name to mean ‘Lord of the Tree of Truth.
Three times Three
The Royal Arch Degree is speaking of the Lost Word that Masonry has preserved. The Lost Word of Masonry is the Sacred Name of YHWH, the ‘divine Logos.’ The initiate is then given this Lost Word, which has been passed down as Jahbulon and the 3 times 3 ritual is done.
Duncan’s Masonic Ritual and Monitor 249
“Each one takes hold with his right hand of the right wrist of his companion on the left, and with his left hand takes hold of the left wrist of his companion on the right. Each one then places his right foot forward with the hollow in front, so that the toe touches the heel of his companion on the right. This is called “three times three;” that is, three right feet forming a triangle, three left hands forming a triangle, and three right hands forming a triangle. They balance in the same manner, and then, with hands raised, repeat the words Jah-buh-lun, Jehovah, G-o-d, at low breath, as described before.”
Secret Architecture of Our Nation’s Capital pg 117
“The number 27 is the Masonic three times three, a reference to the ‘Living Arch’ which, according to revelations of the secrets of Masonry published by Avery Allyn in 1831, symbolized the human Royal Arch. This was an arch formed by Masons when ritualistically pronouncing or portraying the secret name of God.
The symbolism was fairly obvious. There was a triple bonding of right arms above the heads of the participants, a triple bonding at the heart level, and a triple touching at the feet, which were arranged to form a triangle upon the floor. Symbolically, the three levels of Creation united: the Trinity of Heaven passed through the Trinity of Man to form a Trinity on the Earth.”
The three times three ritual is a picture of the triquetra which is a form of the number 666.
Triquetra
The triquetra is a combination of 3 ‘vesica piscii’ {see part 12click here}each with the height to width ratio of 1.73205 which is the square root of 3. This ratio is linked to 153 (the complete mathematical ratio being 265:153, the ratio of whole numbers under 1000, which approximated the square root of 3.) 153 is the number of fish caught in John 21:11 where Messiah appears to His disciples.
153 represents the Sons of God as ‘bnai ha’elohim’ has the gematria of 153. This is what it all comes down to. Being sons of God through faith in Messiah. Being ‘reborn’ into His image. Or being ‘sons of god’ through the tree of knowledge. Being ‘reborn’ into the image of the beast.
The 153 fish were caught in a net. The word net comes from the Greek ‘dikruon’ which traces back to the Hebrew word ‘reshet.’ ’Reshet’ comes from the root רש which is also the root word for ‘erosh’ which means betroth. Here we see a deep connection to the 153 fish being the bride of Messiah. The counterfeit is represented by the triquetra, a symbol of the bride of the beast.
Triple Helix & DNA ‘repair’
The potential for DNA repair to heal diseases has been spoken of in recent times, especially since the human genome project was finished and the human genome has been mapped out.
Triple Helix: Designing a New Molecule of Life
December 2008 Scientific American Magazine
Peptide nucleic acid, a synthetic hybrid of protein and DNA, could form the basis of a new class of drugs—and of artificial life unlike anything found in nature
By Peter E. Nielsen
http://www.scientificamerican.com/article.cfm?id=triple-helix-designing-a-new-molecule&page=4
Scientists are already working on manipulation of DNA and the formation of artificial life. The above article is one example of such research.
The Potential for Gene Repair via Triple Helix Formation – Michael Seidman and Peter Glazer
“Triplex-forming oligonucleotides (TFOs) can bind to polypurine/ polypyrimidine regions in DNA in a sequence-specific manner. The specificity of this binding raises the possibility of using triplex formation for directed genome modification, with the ultimate goal of repairing genetic defects in human cells. Several studies have demonstrated that treatment of mammalian cells with TFOs can provoke DNA repair and recombination, in a manner that can be exploited to introduce desired sequence changes.”
Scientists Create ‘Cyborg’ DNA 3/1/11
http://news.softpedia.com/news/Scientists-Create-Cyborg-DNA-186819.shtml
“A group of researchers in Denmark is working on creating something entirely new on this planet – lifeforms that contain an improved version of the double-helix DNA. They are, for all intents and purposes, seeking to create stable, triple-helix deoxyribonucleic acid.
Since the acid was first discovered, experts have known that it features two strands, which dance around each other and form a distinctive, double-helix structure. All complex organisms contain DNA, and all of them feature variations of this configuration.
But the Danish team apparently finds this underwhelming, and is trying to introduce a third strand into DNA. They have already achieved success in their attempts, and they are currently engaged in solving some unforeseen problems that appeared as they created the “cyborg” DNA.
The group, which is based at the University of Copenhagen, wants to add a third peptide nucleic acid (PNA) strand to the two DNA strands that already exist in all organisms. The research team also has some well-grounded reasons for doing so.
One of the main functions the new PNA strand fulfills is block the activity of certain genes – such as for example those that have been associated with elevated risks of developing particular forms of cancer – and boosting the activity of other (that have been proven to be beneficial).
An added advantage that PNA has over DNA is that it’s not limited by default to the four “letters” that DNA uses, G, A, T and C. The new strands can be fashioned from other chemicals than these four.
Researchers from the UC Center for Biomolecular Recognition (CBR) already managed to create a triple-helix structure, by inserting a PNA strand in between two DNA strands. But this move had an unexpected effect.
Rather than a single PNA strand being added to the standard, double-helix structure, two PNA strands forced one DNA strand out of the structure. The end result was a triple-helix containing 2 PNA and 1 DNA strand.
The excess DNA formed a P-shaped loop, which was demonstrated to play a role in making the entire structure replicate a lot faster than normal DNA is capable of.
The only problem with this form of genetic manipulation is that PNA is soluble in water. This means that the strands cannot function inside a human body, for example. The UC team is currently working on developing a means of water-proofing these strands.
Once they manage to do so, they will be able to create stable DNA-PNA triple-helix structures, that could be inserted in lab animals for further testing, Daily Galaxy reports.”
DNA BINDING DRUGS
http://employees.csbsju.edu/hjakubowski/classes/ch331/bind/oldrugdevel.html
“Most drugs in use today bind to specific proteins and interfere with the activity of the protein. Some antibiotics do bind DNA by intercholating nonspecifically between base pairs and interfering with replication and transcription. An alternative new approach is to design drugs that bind to specific sequences of DNA and either promote or inhibit the transcription of key genes. b-hydroxybutyrate is an experimental drug now being used to treat sickle-cell anemia. Somehow it increases the transcription of fetal hemoglobin genes, which form proteins which do not aggregate as the sickle cell hemoglobin gene product does. These approach has been called chemical genetics. Stuart Schreiber at Harvard has been a leader in the this field.
Another way to inhibitor specific gene transcription is to bind a small single-stranded DNA to the dsDNA to form a triple helix. The single stranded DNA molecule can bind to exposed H bond donors and acceptors of bases not involved in Watson-Crick H-bonding interactions between complementary bases in the ds DNA.”
Could this use of drugs to change DNA be the ‘sorcery’ spoken of in the book of Revelation?
Rev 9:21 And they did not repent of their murders, nor of their sorceries, nor of their fornications, nor of their thefts.
G5331
φαρμακεία
pharmakeia
Thayer Definition:
1) the use or the administering of drugs
2) poisoning
3) sorcery, magical arts, often found in connection with idolatry and fostered by it
4) metaphorically the deceptions and seductions of idolatry
‘Pharmakeia’ is translated in the Septuagint from the Hebrew word ‘kashaph’ which is defined as ‘supernatural powers used by idolaters.’
‘Pharmakeia’ comes from the Hebrew word ‘kashaph’ which is defined as ‘supernatural powers used by idolaters.’ Pharmakei is the origin of the word pharmacy. A pharmacist is one who deals out drugs. In Hebrew this is the word רקח ‘raqach’ which is the word used for compounding oil or ointment. It is the source of the word ‘christos’ in Greek which means christ or anointed one.
The etymology of the English word ‘drug’ brings forth even more fascinating connections to the current study. The word ‘drug’ comes from the Old French word droge which means ‘supply, stock, provision.’ This word is linked with ‘dry wares’ which were dried goods such as spicces and drugs that were carried from one place to another and sold. Drug is a play on words with drag as it can be said that the dried goods were ‘dragged’ from one place to another. This is interesting to note as ‘drag’ and ‘drug’ both trace back to the Hebrew word טרח ‘tarach’ which means a burden, as in something carried on the back. This is the source of the Old Irish word drugaire which means slave.
Digging further, the word drug traces back to the Hebrew סם ‘sam’ which means poison/drug as seen above. ‘Sam’ is the source of the Arabic sana which is where the English word ‘sanna’ meaning drug, herb and plants, comes from. The connection here is the idea of dried fruit and spices and the path traveled to and from them. These have been the main themes throughout this study. The two paths which lead to the two trees in the midst of the garden.
As seen above, 666 in Hebrew would be rendered וסם. The vav in front has the pictograph meaning of a nail which is something that connects or pierces…
Vaccine comes from the Hebrew word ‘baqar’ which means a cow or cattle and is connected with health.
E-Word – Isaac Mozeson pg 119
“BaQaR also means to cleave or split, as in Arabic baqara, and these larger beasts do the ground breaking or plowing. The double entendre in Ezekiel 34:11 infers that cattle are carefully (BQR) ―examined. Every daybreak (BQR) a farmer examines or takes stock of his livestock to see if he has lost or will lose any to sickness, or will gain one with a pregnancy.” It should come as no surprise that Messiah is referred to as the Good Shepherd (John 10:11) whereas the antichrist is referred to as the idol/worthless shepherd who does not care for his flock (Zechariah 11:17).
Will vaccines be used to bring about a change in DNA as a cure ‘rapha’ for plagues forthcoming?
The earliest use of the word Charagma (Greek for the mark) outside of the Bible describes the piercing bite of a snake:
Theological Dictionary of the New Testament vol 9, page 416
“[Charagma] is an engraved, etched, branded or inscribed ‘mark’ or ‘sign’. Closest to the original sense[…] is the earliest example in Soph. Phil., 267, where [charagma] denotes the bite of a snake.”
Theological Dictionary of the New Testament (vol 9, page 416)
Charagma – Henry George Liddell, Robert Scott, A Greek-English Lexicon
“any mark engraved, imprinted, or branded, ch. echidnes the serpent’s mark, i.e. its bite, sting”
There is much talk about the Verichip being the mark of the beast. Those who believe this may very well be on the right path. However, a simple microchip that can be used to track people doesn’t fit the Biblical definition. If the mark of the beast is implemented via the use of a vaccine or microchip, it will have to have the ability to change the image of man into a mixture of man and beast.
Star of David and Microcomputer chip
http://www.drpaulose.com/art-forms-of-kerala/painting/star-of-david-and-the-yantras
…”what is most interesting is that the Star Tetrahedron is the geometric shape of a Silicon micro-¬computer chip.
The Star Tetrahedron is the electric balance to magnetism. This is how data is stored so efficiently within a computer. It is this geometric shape that provides for memory.
The word memory takes its origins from the ancient Hebrew words mem, which means Water and ohr, which means Spirit.
“Jesus answered, I say unto thee, Except a man be born of water and of the Spirit, he cannot enter into the kingdom of God,” John 3:5.
In the periodic table of elements in Chemistry, atomic number of Carbon is 6, Carbon is needed to form DNA and RNA in human body, both contains the chemical code of life.
Carbon atom has 6 electrons, 6 neutrons and 6 protons. =666
Silicon also has the same structure as Carbon and it can support life and the microcomputer chip is made of silicon which can store lot of data in its memory.
There comes the secret of computer chip, Star of David and Yantra.”
Life on earth is carbon based. The carbon atom consists of 6 protons 6 neutrons 6 electrons
As seen above, Carbon corresponds to the letter ‘gimel’ in Gregg Braden’s theory on DNA and the Sacred Name. Carbon is the fourth element in the 4 base sequence of the DNA molecule.
God Code – Gregg Braden pg 74
“Alchemists believed that understanding how the fourth element was derived was the key to understanding creation, life and immorality.”
The subject of carbon makes further connections to the current study. Carbon atoms join together to make numerous shapes, 3 of which are significant to this series of studies.
Carbon atoms that form diamond are in the shape of a cube. This cube formation is the shape of New Jerusalem, mentioned above in connection with amino acids. Carbon atoms also form into a ‘buckminster fullerene’ which is a combination of hexagons and pentagons, both of which are images of the mark of the beast. It has been found that the geometry of the cell membrane is in the form of the bucky ball. It is also the formation of the ‘earth grid’ mentioned in part 12click here.
Graphite
When carbon forms graphite it is in the shape of a hexagonal lattice, similar to a beehive.
This formation and its connections to the bee and its hive is fascinating. Graphite formed by carbon is the source of pencil lead, a writing tool. The word graphite traces back to the Greek word ‘graphe’ meaning ‘a written document’ or ‘Scripture.’ The bee in Hebrew is ‘devorah’ a feminine form of the word ‘davar.’ This has been discussed in previous studies and the symbol of the bee being used by the counterfeiter as a proclamation of him being the ‘word.’ Further delving into this connection between carbon, bees and the word is the ancient source for ink.
In ancient times there were 3 main ingredients for the making of a Torah scroll. Gum Arabic taken from the Acacia tree, ash and irong gall or oak gallnut. Gum Arabic is interesting as the acacia tree is the source of the wood for the Tabernacle which was a picture of Messiah and consequently the Word. As seen above, gum arabic also forms a ‘sugar’ called ribose which is the etymologic origin of the word ribosome. The ‘scribes’ in the nucleus of our cells.
Ash is formed by the burning of wood. This charcoal is another form of carbon. In Hebrew Carbon is פחמן which means charcoal or coal from the burning of wood.
Oak gallnut is fascinating as it is formed by the process of bees, in particular hornets, laying their eggs on oak leaves. The tree senses a foreign body and quickly grows a large knot, a gallnut, to keep the foreign body from growing. This also causes the tree to bring forth tannin which then becomes the dye for the ink.
This ink is linked to the mark of the beast as Ezekiel speaks of the mark put on the foreheads of the righteous by a man with an inkhorn.
Eze 9:1 And He cried in my ears with a loud voice, saying, Let the overseers of the city draw near, even each with his destroying weapon in his hand.
Eze 9:2 And, behold, six men were coming from the way of the Upper Gate, which faces north. And each had his shattering weapon in his hand. And one man among them was clothed in linen, and an ink horn of a scribe at his loins. And they went in and stood beside the bronze altar.
Eze 9:3 And the glory of the God of Israel had gone on, from on the cherub where it was on it, to the threshold of the house. And He called to the man clothed in linen with the ink horn of a scribe at his loins.
Eze 9:4 And YHWH said to him, Pass through in the midst of the city, in the midst of Jerusalem, and mark a mark on the foreheads of the men who are groaning and are mourning over all the abominations that are done in her midst.
Eze 9:5 And He said to those in my hearing, Pass over in the city after him and strike. Do not let your eye spare, and do not have pity.
Interestingly, the word for inkhorn is ‘keset’ which can mean a cup used for holding ink in order to write words or an amulet which represents the counterfeit system of images. It is interesting to note that carbon black was one of the primary ancient sources for tattooing.
Berrenda Fox is another researcher whose research points to triple strand DNA.
Dr. Berrenda Fox provides evidence of DNA and cellular changes
http://www.lightandlife.com/new/past_issues/05/E5_ReschandFoxonDNA.htm
“Dr. Fox is the holistic practitioner of the Avalon Wellness Centre in Mt Shasta, California. The Avalon Clinic represents the re-emergence of the ideal of healing as practised on the original Isle of Avalon. Dr Fox has proven through blood tests that some people have actually developed new strands of DNA.”
“Everyone has one double helix of DNA. What we are finding is that there are other helixes that are being formed. In the double helix there are two strands of DNA coiled into a spiral. It is my understanding that we will be developing twelve helixes. During this time, which seems to have started maybe 5 to 20 years ago, we have been mutating. This is the scientific explanation. It is a mutation of our species into something for which the end result is not yet known. The changes are not known publicly, because the scientific community feels it would frighten the population. However, people are changing at the cellular level. I am working with three children right now who have three DNA helixes.”
“These are children who can move objects across the room just by concentrating on them, or they can fill glasses of water just by looking at them. They’re telepathic. You would almost think by knowing these children that they are half angelic or superhuman, but they’re not. I think they are what we are growing into during the next few decades.”
“The easiest way to mutate our DNA is through a virus. Consequently viruses are not necessarily bad. Viruses live only on living tissue. DNA viruses like Epstein Barr and the Herpes #6 change cellular structure. The retrovirus HIV is not a DNA virus. Instead of mutating the body, it actually eats it up. Most people who go through this process and come out the other side have a new profession, a new way of thinking, or at least a starting of a new way of life. Even though they may feel really sick, tired, or hopeless at times, it is a gift. They are being given a chance to change their DNA structure and their body into a lighter, healthier body that can see them into the next generation. The angels that are being seen are signs that we are shifting. As I understand it, we have until about 2012 to complete this process.”
Sending viruses to ‘alter’ ‘God-Gene’ {http://funvax.wordpress.com/}
Scientists have found that inside the human body is a ‘God-gene’ that predisposes them toward spiritual or ‘mystic’ experiences. As far back as 2005, the Department of Defense in the Pentagon began discussing the use of viruses to alter this ‘God-gene’ in order to ‘eliminate’ religious fanatics.
Altering ‘God-Gene’ {http://www.youtube.com/watch?v=gZCoj33wOkA&feature=youtu.be}
Freddie Silva in his book ‘Secrets in the Fields’ links DNA & Crop circles. He uses Berenda Fox’s research as one example of the messages in the crop circles pointing to the evolution of man.
Secrets in the Fields pg 168
“The third piece of supporting evidence for the crop-circle/DNA link comes from a report for Dr. Berenda Fox, a holistic practicioner in the U.S. who researches immunological testing and therapy. Her analysis of blood samples collected since the early 1980s shows that people have developed what appears to be a third strand of DNA. People seem to be changing at a molecular level, says Dr. Fox.”
The Froxfield Serpent of 1991 was examined by Gregg Braden and found that the ‘breaks’ in the coil of the serpent correspond to ‘breaks’ in the human DNA structure. Braden found that of the 64 codons in our genetic code, 44 are unused.
Secrets in the Fields – Freddie Silva pg 165
“Since nature rarely designs things superfluously, such apparent redundancies along the DNA strand may be structure waiting to be activated.”
This is the essence of the DNA connection to the crop circles. They announcements, and in some cases attempts to ‘awaken’ dormant parts of the human DNA in order to bring about the ‘evolution’ of man into godhood.
Secrets in the Fields pg 167-168
“…support for the theory that electromagnetism in crop circles is capable of altering DNA comes from the pioneering work of Dr. Chian Kanzhen (formerly imprisoned Chinese scientist who escaped to Russia), who researches bioenergetic communication…DNA is a passive data storage device comprising active material carriers in the form of bio-electromagnetic signals. These are photons possesing corpuscular and wave properties capable of transmitting energy and information…Any excitation of the bioelectromagnetic field is therefore transmitted to the DNA, and in laboratory experiments genetic information has already been succesfully transmitted from one organism to another.”
Secrets in the Fields pg 168
“Irish molecular biologist and immunologist Colm Kelleher has also researched the structure and properties of the 97 percent of our genetic material that does not code for protein, and discovered that more than a million sequences in human DNA have the property of being able to ‘jump’ from chromosome to chromosome. When activated to jump, these sequences, or ‘transposons,’ are capable of large-scale genetic change in a very short time.
Kelleher proposes that the activation of the transposons is done through the intense spiritual energy experiences in altered states such as shamanic initiations, near-death experiences, and UFO close encounters.”
Secrets in the Fields pg 168-169
“If such hypotheses are correct and molecular changes in the human body are underway, the evolutionary consequences are on cue with ancient predictions that have foreseen changes in humanity’s spiritual and physical structure as it nears the close of cycles. Moreover, indigenous cultures mention that signs would appear on Earth as the changes accelerate.”
Secrets in the Fields pg 169
“Enoch’s teachings [speaking of J.J. Hurtak’s book called the Keys of Enoch] also stipulate that these symbols would help propel humanity from one state to another, aid its spiritual development, and assist science in understanding the Universe. The Light language, Hurtak said, would be given to help us cope with this change: the ‘spiritual gifts of the Holy Spirit given so spiritual man can work with the Light Beings.’
Secrets in the Fields pg 249
“Shapes also influence the functions taking place within. The pyramid shape, for one, is scientifically proven to affect brainwave patterns and crystalline structures, to the point that it mummifies dead tissue, sharpens blunt razor blades, and enhances the micro-organisms in milk and yogurt…Through their use of geometry, acoustic properties, and siting over energy-rich nodes, Gothic cathedrals, in particular, can affect electromagnetic frequencies. When a devotee stands inside these spaces, energy is transferred up the spine to the magnetic deposits in the skull (close to the pineal gland), causing changes in awareness.”
Secrets in the Fields pg 279-280
“…the McKenna brothers present our Universe as a hologram, a creation of two intersecting ‘hyper-universes’…The McKennas propose that our holographic Universe consists of sixty-four (8×8) frequencies, of which ours is but one. As these two hyper-universes intersect, our DNA will need to evolve rapidly to cope with all sixty-four frequencies. The event is said to reach its crescendo in 2012. This date came about when the McKennas programmed a computer with the sixty-four time systems, each based on the sixty-four hexagrams of the I Ching, which itself is said to be a model of the physical structure of a single helical strand of DNA. Recall from previous chapters the evidence suggesting that crop circles may be involved in the process of altering DNA and you see how the subject can get exciting.”
I-Ching, DNA & Kabbalah
The I-Ching comes from the Chinese Taoist religion which is said to consist of 8×8 trigrams (64 hexagrams) energy combinations which represent all possible cosmic and human situations. As seen above, this is the number of codons in the human DNA genome sequence.
Genetic Code, I Ching and Hebrew Alphabet
http://www.world-mysteries.com/sci_noncodingDNA.htm
“INTERPRETING “SEFER YETZIRAH” THROUGH GENETIC ENGINEERING
In the Sefer Yetzirah, we have a magical text which purports to allow those who understand and use it to create living creatures. This is accomplished using 22 letters which are manipulated like bits of clay into chains that are arranged into complementary parallels and other shapes. This is very similar to scientific descriptions of the activity which takes place within the cells of living things. Scientists use the language metaphor to describe these chemicals and their activities. Lengths of DNA and the genes which reside there are refered to as genetic sentences and their chemical components are refered to as words and letters. Counting the stop codons as 2 seperate groups there are 22 amino acid letters in the chemical alphabet of life.
“2. Twenty-Two letters are the foundation: He engraved them, He hewed them out, He combined them, He weighed them, and He set them at opposites, and He formed through them everything that is formed and everything that is destined to be formed.”
In addition to the numerical and functional analogies between the amino acids and the Hebrew alphabet there is a category coincidence as well. The letters of the Hebrew language in the Sefer Yetzirah are arranged into 3 categories.
3 “Mother” letters: Aleph, Mem, Shin
7 “Double” letters: Beth, Gimel, Daleth, Kaph, Pe, Resh, Tau
12 “Simple” letters: He, Vau, Zain, Cheth, Teth, Yod, Lamed, Nun, Samekh, Ayin, Tzaddi, Qoph”
Interestingly, scientists have found that amino acids actually form in a similar 3,7,12 fashion.
http://kglyphicsart.blogspot.com/2011/04/iching-and-genetic-code.html
“Therefore the 64 codons of the genetic code, those that code for amino acids and those that serve as “Punctuation” (start & stop), can be put into the same number of categories with the same number of items in each, as the letters of the Hebrew alphabet.
3 Punctuation groups (2 stop groups, 1 start group [Methionine])
7 Hydrophobic Amino Acids
12 Hydrophilic Amino Acids”
“Note also that each of the 64 hexagrams of the I Ching has 6 lines and so there is a total of 384 lines in all.”
Back to ‘Genetic Code, I Ching and Hebrew Alphabet’
When scientists speak of the chemistry of life they often use the metaphor of language, as pointed out earlier. They also use other metaphors. The strands of DNA or mRNA are also spoken of as “threads” and the entire genome is often refered to as “the thread of life.” I mention this because one of the many translations of Sefer Yetzirah which I have read uses the “thread of life” metaphor extensively.
“The twenty-two letters which form the stamina after having been appointed and established by God, He combined, weighed and changed them, and formed by them all beings which are in existence, and all those which will be formed in all time to come.” (p. 20) (The Ancient and Mystical Order Rosae Crucis – AMORC, translated by Rev. Dr. Isidor Kalisch, 1877)
The word that Kalisch translates as “stamina” is the Hebrew word yesod which others translate (more correctly) as “foundation.” Why Kalisch chose “stamina” is unknown, but its use in this context is provocative since it is derived from the Latin:
STAMINA – the plural of stamen = warp: the thread of life spun by the fates. endurance. Greek stemon = thread. Note that: Stamen – the organ of the flower that produces the male gamete. This shows that “the thread of life” concept was linked early on to the process of reproduction.
So, if we substitute the origin of “stamina” for “stamina” in the text, we get: “The twenty-two letters which form the thread of life after having been appointed and established by God, He combined, weighed and changed them, and formed by them all beings which are in existence, and all those which will be formed in all time to come.”
“This Torah, the linguistic movement of Ein-Sof within itself, is called a malbush (“garment”), though in fact it is inseparable from the divine substance and is woven within it … (the garments) length is made up of the alphabets of the Sefer Yetzirah and had 231 “gates” … which form the archistructure of divine thought. Its breadth was composed of an elaboration of the Tetragrammaton according to the numerical value of the four possible spellings of the fully written names of its letters, … , which were the “threads” and the “weave” that were originally situated in the hem of the garment. … The size of this garment was twice the area necessary for the creation of all the worlds. After it had been woven, it was folded in two: half of it ascended and its letters stood behind the letters of the other half.” (Kabbalah p.132)
We can see then that the tradition of the Hebrews uses the metaphors of clay and threads to explain the creation of all living things, including man. We pass now to the Chinese whose I Ching forms the other half of the occult genetic code. They too have creation myths and traditions that use similar metaphors. The following exerpts are from: “Mythologies of the Ancient World”, Samuel Noah Kramer Ed.
Fu Hsi is the legendary creator of the I Ching. His sister/consort is Nu Kua. She is also portrayed as the creator of mankind:
“It is popularly said that when Heaven and Earth had opened forth, but before there were human beings, Nu-Kua created men by patting yellow earth together. But the work tasked her strength and left her no free time, so that she then dragged a string through mud, thus heaping it up so as to make it into men. Therefore the rich and the noble are those men of yellow earth whereas the poor and the lowly – all ordinary people – are those cord-made men.” (p. 338)
http://www.valdostamuseum.org/hamsmith/ichgene6.html
Jimenez-Montano, Mora-Basanez, and Poschel say:
“… the genetic code may be represented by a six-dimensional boolean hypercube.
This is interesting to note as this cube is the formation of the new heavens and new earth with 12 foundations of the 12 tribes of Israel (those born again into the image of Messiah who is the Word). It is also interesting to note that the I Ching consists of 64 hexagrams where the six lines consist of broken (yin) or solids (yang). As seen in part 12click here, the yin-yang symbol represents ‘as above, so below’ which is referring to the Kingdom.
Katya Walter has shown that the representation of the DNA code (seen in the image above) by Fu Xi’s Ho Tu arrangement of the I Ching is not superficial.
The 55 points of the Ho Tu diagram can be divided into 27 SouthEast points and 28 NorthWest points, if the central point is put into the NorthWest part.
The G-C base pair has 15 ring atoms and 12 other atoms, just as the SouthEast part has 15 even points and 12 odd points.
The T-A base pair has 15 ring atoms and 13 other atoms, just as the NouthWest part has 15 even points and 13 odd points.
Notice the similarity of the formation above and the formation of the camp of Israel in the wilderness.
Another connection to the above information is the breastplate of the High Priest. The breastplate (חשן choshen) was four square just like the cube formation above. It was held on to the ephod by a ‘blue ribbon’. In Hebrew this is ‘pathiyl techelet’ which is linked to the tsitsit mentioned above which is a picture of DNA with its twisting threads being likened to the DNA helix. Patiyl has the meaning twisting fibers together.
Here the picture is seen on the breast of the High Priest of DNA strands which flow into a four-square breastplate which pictures amino acids. This is further displayed in that the breastplate ‘choshen’ was translated into the Greek Septuagint as ‘logeion’ which means an oracle or word. Tradition speaks of the Urim and Thummin being used in conjunction with the 12 stones of the breastplate in order for YHWH God to speak to Israel.
THE BREASTPLATE OF THE HIGH PRIEST – H. Meij
http://cointrade.awardspace.com/MasonicKnowledge/THE%20BREASTPLATE%20OF%20THE%20HIGH%20PRIEST.html
“When someone had to make an important decision, the request was made known to the high priest. He would stand before the lampstand near the altar, holding the Urim in one hand and the Thummin in the other. As the light from the candle reflected from the Urim and the Thummin onto the stones of the Breastplate, this flash of light provided up to 24 combinations (2 x 12). Since there are 22 letters in the Hebrew alphabet, the flashes of light could produce strings of letters. It was said that God breathed through the wind, which in turn causes the veil to move, permitting a breeze to flicker the flames in the Lampstand to momentarily alter the angle of direction of the light onto the Urim and Thummin, and thence to the Breastplate. Thus God was able to communicate directly, but not audibly, to the high priest and answer the enquiry.” {Choshen is the root of the English word ‘hush’}
Interestingly, according to the Targum, the threads of the breastplate consisted of six blue threads, six purple threads and six scarlet. As seen in previous studies, many of the articles of the Temple system were encoded with 666. This is because the Tabernacle/Temple were to be microcosms of the universe which YHWH God created in 6 days. The adversary seeks to be like the Most High so the number 666 was ‘stolen’ by him and applied to himself. Could the Adam Kadmon golem mentioned above come to earth appearing as Messiah who is the High priest bringing fire down from heaven to consume the sacrifices making it appear that YHWH has accepted the counterfeit temple? Will he further deceive mankind by the breastplate that he uses which will miraculously speak via a form of the Urim & Thummim?
Rev 13:13 And it does great signs, that it even causes fire to come down out of the heaven onto the earth before men.
Rev 13:14 And it deceives those dwelling on the earth, because of the signs which were given to it to do before the beast, saying to those dwelling on the earth to make an image to the beast who has the wound of the sword, and lived.
Rev 13:15 And was given to it to give a spirit to the image of the beast, so that the image of the beast might even speak, and might cause as many as would not worship the image of the beast to be killed.
The Watchers & Crop Circles
Freddie Silva quotes the ‘trance readings’ of Isabelle Kingston, who is supposed to be channeling the ‘Watchers’ who make the crop circles. It is interesting to hear what they are saying in regards to the current study.
Secrets in the Fields pg 279
“Her trance readings with the Watchers offer us insights into the purpose behind the crop circles.
Here are some excerpts from Isabelle Kingston’s channelings of the Watchers:
‘You ask the meaning of your circles in the fields. you have been made aware of the presence of the Watchers. Watchers is a name of collective intelligence which guides you mortal humans. It is an intelligence from outside the planet, linked to angelic beings, part of cosmic consciousness. We have been coming for years and years and this has happened many times before. We have been linked with humanity to bring the power necessary to build the New Jerusalem…”
Secrets in the Fields pg 280
” ‘They came before in human form,’ Isabelle [Kingston] said. ‘They were the ones who were the ancient teachers and the tall beings that are in every culture. They said that in order for them to communicate with us they needed to set up the right vibration; and the vibration wasn’t just people’s psyches but also the energy of the planet, because they are interstellar. That’s why the Watchers laid down sacred sites as communication points to be available at a time when it was necessary for them to be in contact with us again.”
Triple Helix & the Star of David – ‘Tri-Loop’
This picture was taken by Dr. Asher Eder about 40 years ago. He found out that it resembles another Star of David he saw in the ruins of an Herodian building in Beth-El, north of Ramallah. It is an ancient Jewish symbol called tri-loop.”
Tri-loop & the connection to DNA
Scientists studying RNA have found that it has a ‘tri-loop’ structure. { A comparative analysis of the triloops in all high-resolution RNA structures reveals sequence–structure relationships -http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1950765/}
Panspermia
Francis Crick, who along with James Watson discovered the DNA helix believed that the DNA molecule is proof of intelligent design. Instead of glorifying the Creator however, he holds to a belief that extraterrestrial life of some sort ‘seeded’ life on earth. This seeding is know as Panspermia. This traces back to the Annunaki of the Sumerians and the Nummos of the Dogons.
“Crick proposed, in a book called Life Itself, that some form of primordial life was shipped to the earth billions of years ago in spaceships—by supposedly ‘more evolved’ (therefore advanced) alien beings.” (Panspermia, <www.pathlights.com/ce_encyclopedia/20hist11.htm#Rocket%20Sperm>, 30 May 2003)
Richard Dawkins, perhaps the most famous atheist of our times, holds to the same doctrine.
Richard Dawkins on his interview in Ben Stein’s Movie “Expelled”
Dawkins: “I patiently explained to him that life could conceivably have been seeded on Earth by an alien intelligence from another planet”
Scientists confirm Extraterrestrial genes in Human DNA
http://www.agoracosmopolitan.com/home/Frontpage/2007/01/26/01340.html
Exo-scientists are critically inspired by the work of Dr. Francis Crick. In his book Life Itself: Its Origins and Nature (1981), Crick — a Nobel prize-winner and the co-founder of the shape of the DNA molecule — claimed an advanced civilisation transported the seeds of life to Earth in a spacecraft. Nobel laureate Dr. Francis Crick who posits an extraterrestrial origin for life on Earth, is not alone in this viewpoint within the scientific community. The same year that Life Itself was published (1981), Sir Fred Hoyle authored Life from Space, in which he took essentially the same position. In fact, in an article that year in Nature, he wrote:
“The likelihood of the formation of life from inanimate mater is one to a number with 40,000 noughts after it…. It is big enough to bury Darwin and the whole theory of evolution. There was no primeval soup, neither on this planet nor on any other, and if the beginnings of life were not random, they must therefore have been the product of purposeful intelligence.” (Hoyle: 1981, 294:148).
Dr. Hoyle opted for a kind of pantheistic intelligence that created life spores in other parts of the Universe, with these spores ultimately drifting to Earth to begin life as we know it. Because of the tremendous (and impressive) complexity of life-and the obvious design behind it — other scientists who challenge “official science” supported by political elites, are beginning to endorse this conclusion as well. Leslie Orgel, one of the well-researched heavyweights in origin-of-life experiments, is also on record as advocating this scientific position (1982, pp. 149-152).
Dr. Francis Crick was one of the two scientists who discovered the structure of DNA during the 1950s. Certainly an important discovery in the history of science, this came after lengthy research and a great pooling of information and expertise. Crick won the Nobel Prize for his work. Dr. Crick applied the same rigorous disciplinary standards to his Extraterrestrial origins findings.
In his book Life Itself, Dr. Crick said that creatures from another solar system brought the seeds necessary for life to lifeless planets and, thanks to their kind intervention, life began here.
Nobel Laureate Dr. Crick’s work, is consistent with the apparent findings of “Professor Sam Chang” of the Human Genome Project, who has been credited for seeking to release scientific findings concerning evidence of Extraterrestrial contact in Human DNA.”
Sons of God
There are two paths that man can choose. The tree of Life and Messiah Jesus or the tree of knowledge of good and evil and the beast/satan. Man can repent and die to himself to be made alive through Jesus and the resurrection or man can seek to be made ‘gods’ through the fallen angels.
Spear of Destiny pg 250
“The New Man would have intrepid countenance, giant stature, glorious physique, and superhuman strength. His intuitive powers would mightily transcend mere intellectual thinking, a magical faculty of imagination, a kind of superhuman picture consciousness, obviating the need for the sense bound combination of intellectual and abstract thoughts.
This Superman, who would arise in our midst in so short a time, would manifest magical faculties including magical powers of speech, which all lesser mortals would be powerless to disobey. All spirits between heaven and earth would obey his commands. Even the weather and the chemical combinations of the elements would be subject to his acoustic powers. Such Supermen would become the elite of the earth, the Lords of all they surveyed. Nothing would be hidden from their spirit-vision and no power on earth would prevail against them. ‘They will be the Sons of the Gods,’ said Hitler.”
And the key to this staggering potential in man? It would be realized through the nature and quality of the blood!”
In the 1930′s DNA had not yet been discovered so what Hitler was speaking of in regards to the blood, may very well have been a reference to DNA.
Adam Kadmon – 666
“MYSTICS AND GNOSTICS CALL THOSE WHO ARE ILLUMINATED BY SATAN, GIANTS/BENI ELOHIM – FOR THEY HAVE TAKEN ON THE IMAGE OF THE BEAST/ANTICHRIST – ADAM KADMON”
…These cosmocreators are called in Kabbalah “BENI ELOHIM,” which in English means the Children of the Elohim or the Children of the Gods – who reached Self-realization (LUCERFERIC ILLUMINATION)… These children of the Beni Elohim were the latest Lemurians; at that time there were in humanity the Nephilim GIANTS; the Lemurians were huge human beings that were on the Earth.”
http://gnosticteachings.org/courses/twenty-two-arcana/arcanum
gnosticteachings.org/courses/…two…/arcanum-16-transcription
“The Adam Kadmon
From the beginning of time, Prophecies and Myths have spoken of Humankind evolving into a “God Like” being. The Kaballah has called this being of prophecy the Adam Kadmon – which means literally, “God Human”. The Mystery Schools have spoken of the Great Work – defined as reuniting the Body and Soul with the Spirit. Which is the transformation of the self, into the highest potential being – striving to reach this exalted state.”
“Every culture has its legend of a perfected God-Human which will emerge at the end of Human Evolution. Every culture has its legend of the first human, who was a being like ‘The God and Goddess’. This God-Human is a being of God-like power, God-Like creativity, and lives in a state of ‘divine contact’. The God-Human of mythology symbolizes both the beginning and the end of Human Kind. It is the Alpha and Omega – the beginning and the end.”
Recall in part 1 that the word for mark is traced back to את from whence ‘Alpha and Omega’ is derived.
“The Adam Kadmon Workshops are about living in a new way, in order to become a different kind of Human. The teachings are simple, they are followed by a 24 Strand DNA Activation” which is designed to create that “return to the Divine State”.
Divine Law is: As Above – So Below. The Mystery teachings are: Everything, which exists in the physical, must first be created in the Spirit. Everything physical has its counterpart in Spirit. If there are 12 strands of physical DNA, there are 12 Spiritual DNA strands. DNA Activation must include both the Spiritual as well as the physical.
All Mystery School traditions have a Ritual and Activation Process which results in activation of 11 of 12 strands (which we call “Codons”) of the Physical and Spiritual D.N.A. The two Codons which are not activated by this method are called the Galactic Code (physical DNA), and the Divinity Code (Spiritual DNA). All mystery school traditions have taught that when humankind is ready, a technique would be given to activate the last two Codons. The Activation of these Codons would result in the manifestation of the Adam Kadmon, that God-Like Human.
This is work that King Salomon began, nearly 3000 years ago. Finally, we may finish this! We may complete the cycle and become the perfected human – transforming from Humankind to Humanity. This is the most glorious time to live in!”
Believers are/will be the sons of God through the redemption of our bodies.
Joh 1:12 But as many as received him, to them gave he power to become the sons of God, even to them that believe on his name:
Joh 1:13 Which were born, not of blood, nor of the will of the flesh, nor of the will of man, but of God.
Tit 3:5 Not by works of righteousness which we have done, but according to his mercy he saved us, by the washing of regeneration, and renewing of the Holy Ghost;
Tit 3:5 He saved us, not by works of righteousness which we have done but according to His compassion, through the washing of rebirth, and renewal by the Set-apart Spirit,
1Pe 1:23 Being born again, not of corruptible seed, but of incorruptible, by the word of God, which liveth and abideth for ever.
1Jo 3:9 Whosoever is born of God doth not commit sin; for his seed remaineth in him: and he cannot sin, because he is born of God.
Jam 1:18 Of his own will begat he us with the word of truth, that we should be a kind of firstfruits of his creatures.
Jas 1:21 On account of this, putting away all filthiness and overflowing of evil, in meekness receive the implanted Word being able to save your souls.
In the resurrection we shall be given glorified bodies like the Messiah. The Last Adam of 1 Corinthians 15:45
1Jo 3:1 Behold, what manner of love the Father hath bestowed upon us, that we should be called the sons of God: therefore the world knoweth us not, because it knew him not.
1Jo 3:2 Beloved, now are we the sons of God, and it doth not yet appear what we shall be: but we know that, when he shall appear, we shall be like him; for we shall see him as he is.
Mat 22:30 For in the resurrection they neither marry nor are given in marriage, but they are as the angels of God in Heaven.
Sons of God through the redemption of the body
Rom 1:1 Paul, a slave of Jesus Christ, a called apostle, separated to the gospel of God,
Rom 1:2 which He promised before through His prophets in the holy Scriptures,
Rom 1:3 concerning His Son who came of the seed of David according to flesh,
Rom 1:4 who was marked out the Son of God in power, according to the Spirit of holiness, by the resurrection of the dead, Jesus Christ our Lord;
Rom 8:16 The Spirit Himself witnesses with our spirit that we are children of God.
Rom 8:17 And if children, also heirs; truly heirs of God, and joint-heirs of Christ, if indeed we suffer together, that we may also be glorified together.
Rom 8:18 For I calculate that the sufferings of the present time are not worthy to compare to the coming glory to be revealed in us.
Rom 8:19 For the earnest expectation of the creation eagerly awaits the revelation of the sons of God.
Rom 8:20 For the creation was not willingly subjected to vanity, but through Him subjecting it, on hope;
Rom 8:21 that also the creation will be freed from the slavery of corruption to the freedom of the glory of the children of God.
Rom 8:22 For we know that all the creation groans together and travails together until now.
Rom 8:23 And not only so, but also we ourselves having the firstfruit of the Spirit, also we ourselves groan within ourselves, eagerly expecting adoption, the redemption of our body;
The entrance to the Kingdom and the true path is summed up by Paul in Philippians 3.
Php 3:8 But, no, rather I also count all things to be loss because of the excellency of the knowledge of Christ Jesus my Lord, for whose sake I have suffered the loss of all things and count them to be trash, that I might gain Christ
Php 3:9 and be found in Him; not having my own righteousness of Law, but through the faith of Christ, having the righteousness of God on faith,
Php 3:10 to know Him and the power of His resurrection, and the fellowship of His sufferings, having been conformed to His death,
Php 3:11 if somehow I may attain to a resurrection out of the dead.
Php 3:12 Not that I already received or already have been perfected, but I press on, if I also may lay hold, inasmuch as I also was laid hold of by Christ Jesus.
Php 3:13 Brothers, I do not count myself to have laid hold, but one thing I do, forgetting the things behind, and stretching forward to those things before,
Php 3:14 I press on after a mark for the prize of the high calling of God in Christ Jesus.
Php 3:15 Then as many as are perfect, let us be of this mind; and if you think anything differently, God will also reveal this to you.
Php 3:16 Yet as to where we have arrived, walk by the same rule, being of the same mind.
Php 3:17 Be fellow-imitators of me, brothers, and consider those walking this way, even as you have us for a pattern.
Php 3:18 For many walk as hostile to the cross of Christ, of whom I often told you, and now even weeping I say it,
Php 3:19 whose end is destruction, whose god is the belly, and who glory in their shame, the ones thinking earthly things.
Php 3:20 For our citizenship is in Heaven, from where we also wait for a Savior, the Lord Jesus Christ,
Php 3:21 who will transform our body of humiliation, for it to be conformed to His body of glory, according to the working of Him to be able even to subject all things under Himself.
Act 14:22 Confirming the souls of the disciples, and exhorting them to continue in the faith, and that we must through much tribulation enter into the kingdom of God.
The path to the kingdom and eternal life is through Messiah where man must die to himself that Messiah might be formed through us.
Gal 2:20 I have been crucified with Christ, and I live; yet no longer I, but Christ lives in me. And the life I now live in the flesh, I live by faith toward the Son of God, the One loving me and giving Himself over on my behalf.
Gal 2:21 I do not set aside the grace of God; for if righteousness is through Law, then Christ died without cause.
This is a deep concept as the ‘law’ spoken of by Paul in Galatians 2:21 is seen in our bodies in the DNA molecule as this study has explained in detail. Righteousness only comes through faith in Messiah and the nailing of that law to the tree. Eternal life can only be gained through the ‘death’ of our current DNA.
Col 2:9 For in Him dwells all the fullness of the Godhead bodily;
Col 2:10 and having been filled, you are in Him, who is the Head of all rule and authority,
Col 2:11 in whom also you were circumcised with a circumcision not made by hands, in the putting off of the body of the sins of the flesh, by the circumcision of Christ,
Col 2:12 being buried with Him in baptism, in whom also you were raised through the faith of the working of God, raising Him from among the dead.
Col 2:13 And you, being dead in the deviations and the uncircumcision of your flesh, He made alive together with Him, having forgiven you all the deviations,
Col 2:14 blotting out the handwriting in the ordinances against us, which was contrary to us, even He has taken it out of the midst, nailing it to the cross;
Col 2:15 having stripped the rulers and the authorities, He made a show of them in public, triumphing over them in it.
Messiah triumphed over His enemies, the last of which was death (1 Corinthians 15:54-56) which came forth from sin brought forth by the serpent in the tree of knowledge (Hebrews 2:14; 1 Corinthians 15:21, 26). It is no surprise then that Messiah was crucifed on a cross in the shape of the chromosome, portraying Himself as a serpent on a tree (John 3:14) which is a figure of DNA.
The counterfeit path is ‘as above, so below.’ Man becoming god, knowing good and evil and choosing his own way. ‘Do what thou wilt shall be the whole of the law.’ The true path is to die to the flesh that we might live to the Spirit (Romans 8:13). The false path is preservation of the flesh, the ultimate fulfillment of which is manipulation of DNA in on attempt to overcome death. On a deeper level, this preservation of the flesh is another form of ‘works of the law.’
Gal 2:16 Knowing that a man is not justified by the works of the law, but by the faith of Jesus Christ, even we have believed in Jesus Christ, that we might be justified by the faith of Christ, and not by the works of the law: for by the works of the law shall no flesh be justified.
We are saved by grace through faith. In Ephesians 2, Paul sums up this study. Man is dead due to sin. Corruption entered the DNA of man when the fruit of the tree of knowledge was consumed. Man must now die. Through faith in Messiah however, man can yet live. Man can be born again with a new body in the Image of Him who saved him.
Eph 2:1 and you being dead in deviations and sins,
Eph 2:2 in which you formerly walked according to the course of this world, according to the ruler of the authority of the air, the spirit now working in the sons of disobedience,
Eph 2:3 among whom we also all conducted ourselves in times past in the lusts of our flesh, doing the things willed of the flesh and of the understanding, and were by nature the children of wrath, even as the rest.
Eph 2:4 But God, being rich in mercy, because of His great love with which He loved us,
Eph 2:5 even we being dead in deviations, He made us alive together with Christ (by grace you are being saved),
Eph 2:6 and raised us up together and seated us together in the heavenlies in Christ Jesus,
Eph 2:7 that He might demonstrate in the ages coming on, the exceeding great riches of His grace in kindness toward us in Christ Jesus.
Eph 2:8 For by grace you are saved, through faith, and this not of yourselves; it is the gift of God;
Eph 2:9 not of works, that not anyone should boast;
Eph 2:10 for we are His workmanship, created in Christ Jesus unto good works, which God before prepared that we should walk in them.
Eph 2:11 Because of this, remember that you, the nations, were then in the flesh (those having been called Uncircumcision by those having been called Circumcision in the flesh made by hands)
Eph 2:12 that at that time you were without Christ, alienated from the commonwealth of Israel and strangers of the covenants of promise, having no hope and without God in the world.
Eph 2:13 But now, in Christ Jesus you who then were afar off, came to be near by the blood of Christ.
Eph 2:14 For He is our peace, He making us both one, and breaking down the middle wall of partition,
Eph 2:15 in His flesh causing to cease the enmity, the Law of the commandments in decrees, that He might in Himself create the two into one new man, making peace,
Eph 2:16 and might reconcile both in one body to God through the cross, slaying the enmity in Himself.
Eph 2:17 And coming, He proclaimed “peace to you, the ones afar off, and to the ones near.” Isa. 57:19
Eph 2:18 For through Him we both have access by one Spirit to the Father.
Eph 2:19 So, then, you are no longer strangers and tenants, but you are fellow citizens of the saints and of the family of God,
Eph 2:20 being built up on the foundation of the apostles and prophets, Jesus Christ Himself being the cornerstone,
Eph 2:21 in whom all the building being fitted together grows into a holy temple in the Lord,
Eph 2:22 in whom you also are being built together into a dwelling place of God in the Spirit.
חן Chen = 58
Lev 17:11 For the life of the flesh is in the blood*, and I have given it to you on the altar, to atone for your souls; for it is the blood which makes atonement for the soul.
*b’dam he…literally in His blood. This phrase = 58

It is only through faith in the blood of the Lamb that we can find His grace. It is through the blood of the Lamb of God that we enter into covenant with the Most High and are brought into the camp of the righteous. The gates of the righteous are opened (Psalm 118:20) so that we can enter in through the door of the sheepfold who is the Messiah (John 10:7).
The name Noah = 58

Noah comes from the word nuach meaning rest.

Nuach comes from the root:

‘Nuach’ is first used in reference to the Garden of Eden.
Gen 2:15 And YHWH God took the man and put (nuach) him into the Garden of Eden, to work it and to keep it.
This is the picture that Psalm 23 paints. The end of the exile where the Good Shepherd leads us to the still waters. The pictograph meaning of this word (nuach) also can mean the seed inside the walls as in His people in the camp.
The garden = 58

The kingdom, His rest, His nuach is the garden of Eden restored.

Grace literally means the camp of the family. Israel in the wilderness, dwelling in camps with the Glory of YHWH in their midst is the perfect definition of Grace.

This is what grace looks like:
How is the Kingdom of Heaven going to be set up?
Rev 21:10 And he carried me in spirit onto a great and high mountain, and showed me the great city, holy Jerusalem, coming down out of Heaven from God,
Rev 21:11 having the glory of God. And its light was like a very precious stone, as a jasper stone, being clear as crystal,
Rev 21:12 and having a great and high wall, having twelve gates, and twelve angels at the gates and names having been inscribed, which are of the twelve tribes of the sons of Israel.
Rev 21:13 From the east, three gates; from the north, three gates; from the south, three gates; and from the west, three gates.
Rev 21:14 And the wall of the city had twelve foundations, and in them the names of the twelve apostles of the Lamb.
littleguyintheeye@gmail.com
























































































































