DNA is a physical picture of the Word of God, it is a language that functions exactly the same as Hebrew, the language that traces back to Eden. DNA is the language of the book that is used to form our bodies, just as the Hebrew language is the language of the Word who became flesh and dwelt among us.
The DNA molecule is the instruction manual for the forming of amino acids which make the structural elements of proteins that turn into the biochemical units that drive all biological processes.
The proteins formed from the amino acids which the DNA molecule makes are 22 in number corresponding to the 22 letters in the Hebrew Aleph-Bet. These 22 letters point to Messiah Jesus who is described as the Alpha & Omega/Aleph – Tav. The word for sign above is אות which is the same word in Hebrew word a ‘letter’. The 22 letters of the Hebrew Aleph-Bet form the Image of the Messiah who is the Word made flesh. This is seen in the physical realm in our bodies where the DNA forms 22 amino acids which make the proteins for each individual part of our bodies.
Isa 8:18 Behold, I and the children {Messiah and His body} whom YHWH has given to me are for signs (אתות ‘otot’– ‘letters’) and wonders in Israel from YHWH of Hosts, who dwells in Mount Zion.
Etymology of DNA
DNA is an abbreviation for deoxyribonucleic acid. When breaking down the different parts of this word it is seen that etymologically DNA points to the Word. This is no surprise as functionally, DNA is a picture of the Word.
The first part of the word is ‘de’ which means ‘from or according to.’ As in ‘de facto’ meaning in fact or reality in Latin.
This could translate into Hebrew as lamed or mem. In Aramaic the ‘d’ in front of a word is the same as ‘b’.
de – from, down from
The next part of deoxyribonucleic acid is the oxy. Oxy is a Greek word which means sharp or pungent. It is the origin of the word acrid. Oxy/Oxus in Greek traces back to the Hebrew word קוץ (qots) which means a thorn, or sharp. It is the origin of the Latin word ‘acacia’ which means a thorn and is used in reference to the wood used in the Tabernacle which is a major theme of this study as the Tabernacle was a shadow picture of Messiah, and consequently the Word.
deoxyribonucleic acid.
Ribose comes from the Hebrew word ‘chalav’ and is related to gum and the Hebrew word ‘gome.’ These all connect to the Word which will be discussed in more detail below. ‘Gome’ is the source for papyrus/paper and the Bible.
deoxyribonucleic acid.
The word nucleic means ‘something that comes from the nucleus.’ Nucleus comes from the Latin word ‘nucleus’ which means a ‘kernel, little nut.’ The word kernel comes from Germanic word ‘kurnilo’ which means the root of corn, ‘seed/grain.’ Kernel traces even farther back to the Hebrew word כרמל ‘karmel.’ ‘Karmel’ means a seed but a seed planted in a Garden in particular.
The word nucleus also links back to the Hebrew word קמט ‘qamat’ which has the meaning of compressing. ‘Qamat’ is the origin of the Old English ‘hem’ which was a doubling over or compressing of the hem. Interestingly, on the hem of the garments of Messiah were placed tsitsit where are intimately linked with DNA.
The final part of deoxyribonucleic acid is the word acid. Acid comes from the Latin ‘acidus’ meaning sour or sharp. Tracing the word acid farther back links it with the Hebrew word ‘zayit’ which means the olive tree. The Olive tree is a picture of Messiah/the Word/the Tree of Life which will be discussed in more detail below.
de – according to
oxi – sharp (Hebrews 4:12 the Word is sharp, like unto a two edged sword)
ribo – sweet (Psalm 119:103) Papyrus/Word
nucleic – Seed (Luke 8:11)
Acid – Olive (Tree of Life – Romans 11).
Life
Life comes forth from the instructions in the DNA molecule. The Holy Scriptures proclaim that the Word = Life.
Joh 6:63 It is the spirit that quickeneth; the flesh profiteth nothing: the words that I speak unto you, they are spirit, and they are life.
See also Deuteronomy 32:47; 1John 1:1-2; Philippians 2:16; John 11:25; 14:6; 1John 5:20.
The English word life comes from the Hebrew word חלב ‘chalav’ which means ‘fat, choicest part, milk.’ Interestingly, the word protein traces back to this same Hebrew word. Life comes forth from the proteins produced by the DNA molecule in the cell of living organisms…
Life and its connections to the current study are discussed in more detail in Messiah in the Torah: Genesis 1:20-23.
523
The Hebrew word for Father, אב, also equals 523 in ‘full’ value. The Full Value of a word is calculated by replacing each letter of the word with its name, and summing the result.
Further connecting God to the Aleph-Bet is by calculating the entire sum of the Hebrew Alphabet which comes to 1495. This is equivalent to the Greek phrase ‘The Everlasting God.’

Going back to the number 523, it is interesting to note that the Greek word ἐγερσις ‘egersis,’ which means ‘resurrection’ (Matthew 27:53) also equals 523. As seen in part 1 of the Mark of the Beast series, the resurrection is intimately linked to the mark.
Protein & Hebrew
Interestingly the English word protein traces back to the Hebrew word ‘avar’ which is from whence the word ‘Hebrew’ עברית ‘ivrit’ comes from. Protein comes from the Greek word ‘protos’ which comes from ‘avar.’
E-Word Dictionary – Isaac Mozeson pg 312
Notice that the word עבר is related to the word בר ‘bar’ which means ‘son’ (Psalm 2:12). It is no surprise then that the prophet Isaiah (Isaiah 8:18) speaks of those who are in Messiah as signs/letters (אות) and children/’protein’. Notice that the 22 amino acids which correspond to the 22 letters of the Hebrew Aleph-Bet make proteins which correspond to the Hebrew language.
DNA & Language
Nucleotide Character (Letter)
Codon Letter
Gene Word
Operon Sentence
Regulon Paragraph
DNA Book
Simplified it could be said
Nucleotide bases Letters
Codons Words
Genes Sentences
Book DNA
The ‘letters’ of the DNA strand are comprised of Adenine, Guanine, Cytosine and Thymine (A,C,G,T). These four letters combine in pairs to make all the information needed to form life. Adenine always pairs with Thymine and Guanine with Cytosine. This points to the Hebrew language where all words come forth from a 2 letter parent root.
This is also alluded to in Scripture.
Isa 34:16 Search and read from the Book of YHWH; not one of these misses, each not lacking her mate; for He has commanded my mouth, and by His Spirit He has assembled them.
These 2 letter parent roots, for the most part, can’t be used in language without the adding of another letter to form the 3 letter root of which most are familiar with in the Hebrew language. This process happens through the means of messenger RNA. RNA is an exact copy of the DNA molecule where the helix ladder ‘unzips’ itself in order to make an exact copy.
DNA then is a picture of the Father on His throne. The Messenger RNA is a picture of Messiah who comes to earth to bring many sons to Glory. This DNA to RNA and back to DNA process is also seen in the work of the Scribes who made exact copies of the Torah.
DNA, Design, and the Origin of Life
Charles B. Thaxton, Ph.D.
“…the genetic code can be best understood as an analogue to human language. It functions exactly like a code — indeed, it is a code: it is a molecular communication system within the cell…
In recent years, scientists have applied information theory to biology, and in particular to the genetic code… It provides a mathematical means of measuring information…
The conclusion drawn from the application of information theory to biology is there exists a structural identity between the DNA code and a written language…
Molecular biology has now uncovered an analogy between DNA and written human languages. It is more than an analogy, in fact: in terms of structure, the two are ‘mathematically identical.’…”
http://www.redicecreations.com/specialreports/2006/03mar/holygrail.html
“A team of Russian geneticists and linguists, researching the electromagnetic behavior of DNA, discovered that “junk” DNA is critical not only for the construction of our body but also in data storage and communication. The Russian team discovered that this 90% of our DNA follows the same rules of grammar, syntax and semantics as human languages. Their conclusion is that human language mirrors the structure of our DNA.”
Hebrew grammar
DNA works in the same way as the Hebrew language. Each Hebrew word traces back to a 2 letter ‘parent root.’ This parent root, for the most part, can’t be used in a sentence without the addition of a 3rd letter. Hebrew verbs require a 3 consonant root in order to be conjugated. This 3 letter root is called the ‘child root.’
The DNA helix is formed through the combination of 2 nucleotides. Adenine and Thymine or Cytosine and Guanine combinations. In order for amino acids of the genetic code to be formed into proteins the nucleotides must combine into 3 letter combinations to make ‘codons.’
The genetic code consists of 64 codons and the amino acids specified by these codons.
When the DNA is in the nucleus, the DNA contains two letter pairs held together by hydrogen bonds. The letters are unable to form a body without leaving the nucleus and taking on a 3rd letter, just like the Hebrew language. In order to take on a 3rd letter the DNA helix must “unwind”, where it copies itself onto messenger RNA. The letters then make one long string of letters. Just like an ancient Torah scroll.
The DNA strand is made of letters:
ATGCTCGAATAAATGTGAATTTGA
The letters make words:
ATG CTC GAA TAA ATG TGA ATT TGA
The words make sentences:
<ATG CTC GAA TAA> <ATG TGA ATT TGA>
These “sentences” are called genes. Genes tell the cell to make other molecules called proteins. Proteins allow a cell to perform special functions, such as working with other groups of cells to make hearing possible.
NOVA – Ghost in Your Genes
The DNA letters are “transcribed” by Messenger RNA, just as Scribes transcribed one Torah scroll onto another scroll. The messenger RNA is also called the Servant RNA. The Messenger RNA can go outside the nucleus, whereas the DNA must stay inside the nucleus. The DNA does not leave the nucleus in order to preserve the original copy. If the mRNA obeys the rules He will overcome the mutations (sins) of the world when He enters the cytoplasm.
The mRNA leaves the nucleus through a hole called the gatekeeper, that prepares the way for the mRNA to leave the nucleus. When the mRNA leaves the nucleus it is translated.
The 3 letters represent amino acids. There are 22 amino acids that are read by the ribosomes to produce protein. These amino acids are divided up into codons, from the English word code which traces back to the Hebrew word ‘sod’.
Murray Eden of MIT one of the mathematicians attending the Wistar Institute Symposium (1966)
“DNA, like other languages, cannot be tinkered with by random variational changes; if that is done, the result will always be confusion…No currently existing formal language can tolerate random changes in the symbol sequences which express its sentences. Meaning is invariably destroyed.”
You can not add or take away from the DNA or a mutation results.
Deu 12:32 All the things that I command you, take heed to do them and you shall not add to it, nor take away from it.
Mat 5:17 Do not think that I came to annul the Law or the Prophets; I did not come to annul, but to fulfill.
The genetic information that is read by the ribosomes determines what will be formed. Interestingly, tracing back the word ‘information’ brings forth the same concept. The English word ‘information’ comes from the Latin word ‘informare’ which means to shape, form, train, instruct, educate, etc. Informare breaks down from ‘in’ meaning into and ‘forma’ meaning a form. The English word form comes from the Old French word ‘forme’ which means a physical form, appearance, shape, image etc. This traces to the Latin word ‘forma’ which further traces to the Greek word ‘morphe’ meaning form, beauty, outward appearance.
This word ‘morphe’ is interesting as it is used in only a few places in the New Testament, all of which are referring to Messiah. (Mark 16:12; Philippians 2:6-7; Galatians 4:19). ‘Morphe’ comes from the root ‘meros’ which means the constituent parts of a whole. Combining small parts to make an image, this describes DNA becoming protein (image) very well. Morphe is used to translate multiple words, all of which link to the current study.
G3444
morphe H2122 ziv – an image that stands out
morphe H6754 tselem – shadow, image
morphe H8389 toar – mark or image, discussed in greater detail above.
morphe H8403 tavnit – image, pattern- the word used for pattern in reference to the Tabernacle/Temple of YHWH. The significance of this has been discussed throughout this series of studies in reference to Messiah and His body.
morphe H8544 temunah – Image, form- the root of this word is ‘מן’ which means ‘living waters/blood’ usually translated as type or kind which is linked to the passing of genes from father to son through ‘the blood.’
Epigenome
The significance and importance of the epigenome has only recently been discovered by scientists. The genetic material which makes our eyes, ears, nose, feet, liver, heart etc., are all the same. It is the epigenome that translates this information to make each part what it is. This corresponds to the Holy Spirit. The Scriptures can be read by anyone yet it is only through the Holy Spirit that one can understand and see the ‘image’ of God.
Interestingly, the epigenome doesn’t alter the DNA sequence, it ‘turns on’ or ‘turns off’ different parts of the sequence. A good example of this is cancer. Cancer may be caused by several different mutations or epigenetic changes that cause genes to be expressed (turned on) and/or silenced (turned off) when they should not be.
Cancer is an aberration in the cells which leads to death which can be caused by mutations (adding or taking away) or by certain parts of the ‘Word’ being ‘turned on or off.’ Not only does changing the Word lead to death, but misinterpretation of the Word.
Rom 7:24 O wretched man that I am! Who shall deliver me from the body of this death?
Rom 7:25 I thank God through Jesus Christ our Lord! So then I myself with the mind truly serve the Law of God, and with the flesh the law of sin.
The epigenome that ‘translates’ the genetic code is likened to the Spirit. The Holy Spirit teaches man and leads him to interpret the Word correctly where he can be formed into the Image of Messiah. (2 Corinthians 3:18; Galatians 4:19; Romans 8:29) whereas the spirit of evil works in the children of disobedience where the Word is corrupted and leads to them being formed into the corrupted man of sin (Ephesians 2:2-3; Isaiah 1:4; 57:4; 1 Peter 1:13-16).
Interestingly, DNA is dwelling in the midst of a matrix of water. The fact that it is in water plays a crucial role in how it gets its helix ladder shape. Because the four DNA bases are insoluble in water, they turn towards the interior molecule to form and join the two letter ‘roots.’ They then wrap themselves around each other to avoid contact with their wet environment. The epigenome is then likened to the Spirit hovering over the waters in the beginning.
Gen 1:2 And the earth was without form, and void; and darkness was upon the face of the deep. And the Spirit of God moved upon the face of the water.
Gen 1:3 And God said, Let there be light; and there was light.
Psalm 139 speaks of man being formed in the womb and on a deeper level alludes to the DNA molecule.
Psa 139:15 My bones were not hidden from You when I was made in secret; when I was woven* in the depths of the earth. *רקם
râqam…this words means fashion, needlework or twisted threads (DNA).
Psa 139:16 Your eyes saw my embryo; and in Your book (an allusion to DNA the ‘book of life’) all my members were written the days they were formed, and not one was yet among them.
Here we seen that the womb is likened to the earth. In Hebraic thought, the womb is also likened to waters. DNA also produces ‘light.’ Here we see a replay in our very cells of the beginning of the universe.
littleguyintheeye@gmail.com








